Ya la gente está cansada de estudiar y quieren por fin saber; ver, oír, tocar y palpar por sí mismos. La nueva era Acuaria es para ocultistas prácticos; es necesario que aprendan a salir a voluntad en cuerpo astral y viajar con el cuerpo físico en estado de Jinas; Volar con cuerpo de carne y hueso, meterse dentro de los mundos internos, visitar las almas de los muertos, meterse en el mundo de los Ángeles con cuerpo físico, todo esto si es una gigantesca victoria del Espíritu.
 Así podemos transportemos a todos los templos de la Logia Blanca, estudiar a los pies de los grandes maestros, conocer los grandes misterios de la vida y de la muerte; así nos libertaremos de tantas teorías y de tantos intelectualismos absurdos. Nosotros aconsejamos a nuestros discípulos que evitan cuidadosamente el trato con gentes tenebrosas del reino de "Santamaría" (el abismo).
 Los tenebrosos acuarianistas os dirán que salir en cuerpo astral es peligroso así lo han aprendido del peligroso impostor que se hace pasar por Jesucristo. Los teósofos os llenarán de miedo y confusión con sus complicadísimas teorías. Los espiritistas tratarán de confundir vuestras mentes para convenceros de que las cesiones espiritistas son lo mejor de lo mejor; en todos los centros espiritistas, repugnantes y horribles; demonios del abismo suelen presentarse como santos inefables, o como Jesucristos en persona; esas pobres gentes son victimas de las repugnantes larvas y demonios del abismo, y lo más grave es que están convencidos de hallarse en la luz, ningún tenebroso cree que va mal. Los rosacrucistas os dirán que salir en astral es peligroso y que todavía no es tiempo, estos están firmemente convencidos de su superioridad sobre los profanos. Todas esas gentes son del abismo, tienen terrible y espantoso orgullo, y llenas de miedo y fornicaciones; derraman el semen miserablemente por eso son magos negros, sin embargo jamás aceptan que lo son; defienden su adorable fornicación con finas argucias y sutiles filosofías acompañadas de dulces sonrisas y aparente dulzura; toda asociación de fornicarios, es logia negra. Cada escuela de esas es un negocio, y tiene su mandón o jefe que veneran como santo y maestro, estos mandones viven de su escuela, ese es su negocio y lo defienden con dulcisimas e hipócritas palabras; A estos que se hacen pasar por maestros gurús, avataras, hermanos mayores, grandes reformadores, príncipes de la india, etc., no les conviene que sus discípulos aprendan a salir en cuerpo astral, ellos temen verse descubiertos por sus propios discípulos; Además ellos tampoco saben salir en astral menos pueden enseñarlo a otros; Naturalmente tratan de entorpecer a sus pobres seguidores con sus teorías y mete miedos. Hay otros que con el pretexto de organizar la gran fraternidad universal sin distinción de razas, credo, casta o color, se dejan crecer la barba y el cabello y tratan de monopolizar todas las escuelas; Las pobres victimas de la infamia terminan por convertirse en rebaños de cabritos, fanáticos intolerantes y dañinos; Esa es la realidad de estos tiempos, por eso aconsejamos a nuestros discípulos evitar cuidadosamente al trato con esas escuelas del abismo, realmente como están las cosas, lo mejor es no seguir a nadie, es peligrosísimo. Adoremos a nuestro Yo Soy (El Real Ser Interno).
(Misterios Mayores, Cap. 59)
V.M. Samael Aun Weor

Pranayama Crístico Egípcio
Prana es el gran aliento. Prana es el Cristo Cósmico. Prana es la vida que palpita en cada átomo, como palpita en cada sol.
El fuego arde por Prana; el agua fluye por Prana; el viento sopla por Prana; el sol existe por Prana; la vida que tenemos es Prana. Nada podría existir en el Universo sin Prana. No podría nacer el insecto más insignificante, ni brotar la más tímida florecilla sin el Prana.
Prana existe en el alimento que comemos, en el aire que respiramos; en el agua que tomamos, en todo.
Cuando la energía seminal es sublimada y transformada totalmente, provee al sistema nervioso de riquísimo Prana, el cual queda depositado en el cerebro como vino de luz, como energía crística maravillosa.
Existe una estrecha conexión entre la mente, el Prana y el Semen. Controlando la energía seminal con la fuerza de la voluntad, habremos logrado todo porque la mente y el Prana, quedarán entonces bajo nuestro control.
Aquellos que derraman el semen no podrán jamás en la vida controlar la mente ni el Prana. Esos son los fracasados.
Quien logre el control sexual, logrará también el control de su mente, y el control del Prana. Esa clase de hombres alcanzan la liberación. Esa clase de hombres logran el Elixir de Larga Vida.
Todos los inmortales que viven con el Cristo Yogui de la India (el Divino Babají), conservan sus cuerpos físicos a través de millares de años sin que la muerte pueda contra ellos. Esos hermanos después de lograr la suprema castidad, consiguieron el control del Prana y de la Mente.
Prana es energía Universal, es Vida, es Luz, es Alegría.
El principal objetivo de la práctica del Pranayama es lograr la unión de los átomos Solares y Lunares del sistema seminal para despertar el Kundalini.
Los mantrams sagrados tienen el poder de despertar el Kundalini. El Angel Aroch, Angel de mando, nos enseñó el canto mántrico más poderoso que existe en todo el universo para despertar el Kundalini. Cantó el Angel un canto tan conmovedor... un canto tan dulce... y nosotros nos sentimos llenos de éxtasis. Luego el Angel nos invitó a seguir su ejemplo, y nosotros cantamos. Ese canto mántrico se escribe así: Kandil Bandil Rrrrrrrrrr. Ese canto mántrico se canta así: Kan: con voz muy alta. Dil con voz baja. Ban con voz muy alta. Dil: con voz baja. La letra R debe vocalizarse como imitando el ruido de un motor, pero con voz semejante a la del niño. Así hermanos, así es como se canta el canto del Kundalini.
Estos Mantrams se pueden pronunciar repetidamente, a diario, cuantas veces haya oportunidad, por largo tiempo.
Práctica Esotérica:
Primero. Siéntese el devoto en una silla con el rostro hacia el Oriente.
Segundo. Haga mucha Oración, rogándole a la Divina Madre que le despierte el Kundalini.
Tercero. El pecho, cuello y cabeza deberán estar en linea vertical. No se debe doblar el cuerpo a los lados, ni hacia adelante, o hacia atrás. Las palmas de las manos deben descansar sobre las piernas en forma muy natural.
Cuarto. La mente del devoto debe estar dirigida hacia adentro, hacia la Divina Madre, amándola y adorándola.
Quinto. Cierre los ojos para que las cosas del mundo físico no lo distraigan.
Sexto. Tape la fosa nasal derecha con el dedo pulgar vocalizando mentalmente el mantram Ton, a tiempo que respira o inhala muy lentamente el aire por la fosa izquierda.
Séptimo. Clausure ahora la fosa nasal izquierda con el dedo índice. Retenga el aliento. Envíe el Prana a la Iglesia de Efeso situada en el coxis para despertar el Kundalini, y pronuncie mentalmente el Mantram Sa...
Octavo. Exhale ahora lentamente por la fosa nasal derecha vocalizando mentalmente el mantramHan...
Noveno. Clausure ahora la fosa nasal izquierda con el dedo índice.
Décimo. Inhale la vida, el Prana, por la fosa nasal derecha vocalizando mentalmente el mantramTon. Retenga ahora el aliento vocalizando el mantram Ra. Clausure las dos fosas nasales con los dedos índice y pulgar. Envíe el Prana al centro magnético del coxis para despertar el Kundalini.
Once. Exhale muy lentamente por la fosa nasal izquierda vocalizando mentalmente la sílaba mántrica Han.
Doce. Esto constituye un Pranayama completo.
Trece. Seis Pranayamas seguidos deben realizarse al amanecer y al anochecer.
Catorce. El devoto se levantará de su silla y arrodillará en tierra.
Quince. Colocará ahora las palmas de la mano en el suelo tocándose entre sí los dedos pulgares.
Dieciséis. Inclinado hacia adelante, postrado en tierra, lleno de suprema veneración, con la cabeza hacia Oriente, apoyará su frente sobre el dorso de las manos, al estilo Egipcio.
Diecisiete. Vocalizará ahora el devoto con su laringe creadora el poderoso mantram Ra, de los Egipcios. Ese mantram se vocaliza alargando el sonido de las dos letras que componen el mantramR, así: Rrrrrrrrr Aaaaaaaa. Vocalícese siete veces consecutivas.
Estos son los diecisiete puntos del Pranayama Egipcio. El mantram Ra, tiene el poder de hacer vibrar el Kundalini y los chacras para despertarlos.
Los mantrams del Pranayama son Ton-Sa-Ham, Ton-Ra-Ham.
Con el Pranayama se despierta el Kundalini. con el Pranayama se disipan las tenebrosas regiones de las tinieblas y la inercia. Con el Pranayama disipamos la pereza y la torpeza.
El Prana se relaciona con la mente. La mente es el vehículo de la voluntad. La Voluntad debe obedecer a la Gran Alma del mundo.
Todos los vehículos internos deben ser controlados con el Pranayama. Prana es la Vida.
La fosa nasal derecha es solar. La fosa nasal izquierda es lunar. Los dos testigos se relacionan con las fosas nasales. Las vesículas seminales están unidas a los dos testigos, mediante un par de cordones nerviosos. En última síntesis podemos asegurar que los dos testigos del Apocalipsis nacen en las vesículas seminales. Las dos vesículas seminales son los dos océanos de la vida. Cuéntase que Moisés encontró a su Maestro en la confluencia de los dos océanos.
Nosotros hemos enseñado en este capítulo un Pranayama Egipcio para los devotos del mundo Occidental.
Aquellos que quieran despertar el Kundalini deben perseverar diariamente y durante toda su vida en el Pranayama.
La habitación destinada a la práctica del Pranayama no debe ser húmeda, ni tampoco mal ventilada, o sucia. Debe ser una habitación limpia, pura, aseada. También se debe practicar el Pranayama en el campo, en la montaña, a orillas del mar, etc., etc.
Con el Pranayama transmutamos la energía sexual en energía Crística. con el Pranayama despertamos el Kundalini y abrimos los chacras totalmente.
El Pranayama es un sistema de transmutación Sexual para Solteros...
...El Yogui debe tener el vaso de Hermes, herméticamente tapado. El Yogui que sufre de poluciones nocturnas, o que fornica diariamente o constantemente, se parece al hombre que quiere llenar un cántaro, o barril sin fondo. El Yogui debe transmutar el licor seminal en siete tipos de energía. La letra S, tiene el poder de transmutar el licor seminal en siete tipos de energía escalonada. 
La kriya de Babají, el Cristo Yogui de la India, enseña el poder de la letra S (El silbo dulce y apacible). Detrás del silbo muy fino que el Yogui sabe producir con su boca, está la sutil voz, un silbo aun mucho más fino, que cuando resuena en el cerebelo confiere al Yogui el poder de salir instantáneamente en cuerpo astral.
Todos aquellos devotos que estén trabajando con el Kundalini, no deben dejar de practicar con la letra S. La S entonada así Sssssssssssssssss como un silbo muy fino transmuta el licor seminal en el fuego sagrado del Kundalini.
El canto mántrico del Angel Aroch, y el silbo dulce y apacible, son urgentes para despertar el Kundalini...
Transmutación sexual para solteros
 Yoga significa unión con Dios. Nadie puede llegar a la Unión con el Bienamado sin haber despertado primero el Kundalini.
Ningún ser viviente podría despertar el Kundalini positivamente sin haber llegado a la suprema castidad. Es indispensable lavar los pies en las aguas de la renunciación. Porfiad a entrar por la puerta angosta; porque os digo que, muchos procurarán entrar y no podrán (Cap. 13.24 Lucas).
Es urgente saber que la puerta angosta, estrecha y difícil es el sexo. Nosotros salimos del Edem por la puerta del sexo; sólo por esa puerta podemos entrar al Edem. El Edem es el mismo sexo. Nadie puede entrar al Edem por puertas falsas. Tenemos que entrar por donde salimos. Esa es la Ley.
Aquellos estudiantes de ocultismo que por tal o cual motivo no puedan trabajar con el Arcano A.Z.F. deberán conocer a fondo la ciencia de la transmutación sexual. Existe otra llave secreta con cuyo auxilio podrán los devotos solteros abrir el Arca de la Ciencia.
Práctica de Transmutación Sexual para Solteros:
Primera Posición: Los devotos de la senda colocados en el suelo deberán imitar la posición del sapo.
Segunda posición: Los devotos acostados en su lecho (o también el suelo) en decúbito dorsal (boca-arriba) con el tronco inclinado hacia arriba y la cabeza lo más baja posible, deberán entonces inflarse o hincharse como el sapo cuando está furioso.
Actitud mental de la primera posición.
Voluntad e Imaginación unidas en vibrante armonía, identifíquese el estudiante gnóstico con el sapo. Imagínese estar entre un arroyo de aguas puras de vida. Una su voluntad e imaginación para hacer subir sus energías sexuales desde sus órganos sexuales hasta el cáliz sagrado del cerebro. El estudiante gnóstico debe hacer subir su energía seminal por el par de cordones simpáticos que se enroscan en la médula espinal formando el famoso caduceo de Mercurio.
Actitud mental de la segunda posición.
Voluntad e imaginación unidas en vibrante armonía. Inflese el estudiante como lo hace el sapo. Esto sólo es posible con la respiración. Al inhalar el aire vital imaginad a la energía seminal ascendiendo por vuestros dos canales simpáticos que se enroscan graciosamente en la médula espinal. Llevad esa maravillosa energía seminal hasta el cerebro. Luego conducidla hasta el corazón. Entonces exhalad el aire vital fijando la energía en el Templo Corazón. Nuestra divisa es Telema (Voluntad).

Mantram de esta práctica.
Imitad el canto del sapo. Ese misterioso Crioc del sapo es el mantram.

Origen de esta práctica.
La Divina Madre Cósmica nos dio a todos los Hermanos esta maravillosa llave del Arca de la Ciencia. La Madre Divina vela por todos sus hijos. El sapo sobre la flor inmaculada del loto entre las aguas puras de la vida, es un símbolo sexual arcaico en el viejo Egipto de los Faraones.

El ser humano puede desarrollar facultades superlativas trascendentales con las cuales percibimos el ultra de la naturaleza.
Existe la Clarividencia, facultad que nos permite ver en los mundos superiores.
Existe la Clariaudiencia, facultad que nos permite oír en los mundos internos.
Existe la Intuición; sabed vosotros que la intuición está íntimamente relacionada con el chakra del corazón.
También existe en el ser humano la Telepatía. Ese maravilloso poder se haya íntimamente relacionado con el plexo solar situado un poquito arriba del ombligo.
Existe también en el ser humano ciertos chakras que nos permiten recordar nuestras pasadas reencarnaciones. Esos chakras están situados en los pulmones.
Voy a enseñarles a los hermanos los mantrams con los cuales podemos desarrollar nuestras facultades.
Mantram significa palabra de poder. Sabed vosotros que el sonido produce efectos visibles y tangibles para todo el mundo.
Una bala de cañón, por ejemplo, con su sonido hace romper los vidrios de toda una manzana de casas. Una palabra suave apacigua la ira, una palabra irónica provoca muchos sentimientos en el que la escucha. Así, el sonido es la causa causorum de todo lo creado.
Con justa razón dijo Juan: «En el principio era el verbo y el verbo estaba con Dios y el verbo era Dios, por él todas las cosas fueron hechas y sin él nada de lo que es hecho hubiera sido hecho». S. J. Cap. I vers. 1, 2 y 3.
Es conveniente saber pues hermanos que los «mantrams» son palabras de poder. Las vibraciones de esas palabras, de esas letras, de esas múltiples combinaciones de sonidos, despierta los poderes latentes en el ser humano.
Empecemos por conocer los mantrams que sirven para despertar:

Este sentido nos permite ver el «ultra» y se halla íntimamente relacionado con la glándula pituitaria. La glándula pituitaria está exactamente situada entre las dos cejas.
La vocal fundamental de ésta glándula es la vocal «I». Sobre esa vocal se sostienen todos los mantrams relacionados con el poder de la divina clarividencia.
La vocal «I» se pronuncia así:
Se puede vocalizar ésta letra muchas veces. También con esta vocal pueden combinar algunas consonantes y el resultado es asombroso. Así se forman los «Mantrams».
Hay un Mantram que nos permite desarrollar la clarividencia en muy poco tiempo, es el mantram ISIS.
Como sabéis vosotros hermanos la Diosa ISIS era muy venerada en el Egipto. Aquel que logre levantar el velo de ISIS ve el ultra de toda la creación.
Es necesario que vosotros levantéis el velo de ISIS, es urgente que vosotros aprendáis a deletrear los mantrams.
La vocal «I» es el fundamento del mantram ISIS. El Mantrams se pronuncia así:
Como veis vosotros la letra «S» se debe prolongar como un silbido suave y apacible. La letra «S» hace vibrar intensamente al loto maravilloso situado exactamente entre las cejas.
Llegará el día en que si vosotros continuáis con ésta práctica desarrollaréis la divina clarividencia y veréis el ultra de la naturaleza. Entonces todos los misterios de la vida y de muerte serán para vosotros visibles y tangibles.
Otro mantram también muy importante para el desarrollo de la divina clarividencia es el mantrams Suira. Este mantram se vocaliza así:
Podéis vocalizar éste mantrams media hora diaria. Lo importante es no cansarse, lo importante es la tenacidad. Es urgente que cada uno de nosotros aprenda a ser tenaz.
Así es hermanos como vosotros lograréis vuestras facultades.
Es indispensable que seáis constantes, es indispensable que tengáis Fe, es necesario que tengáis profunda devoción interior.
Otro mantrams también muy importante para el desarrollo de la clarividencia es la letra «R». Lo importante es aprender a vocalizar ésta letra dándole una entonación muy aguda, muy fina, imitando la voz de un niño, así:
¿Una voz muy aguda, verdad?. Por eso digo demasiado aguda, difícil para nosotros los varones, pero indispensablemente es necesario para el desarrollo de la clarividencia. Con esa letra despertaréis la clarividencia muy rápidamente.
Podéis vosotros vocalizar estos mantrams dentro de vuestro propio apartamento, en vuestra recámara. Si teméis que alguien os está escuchando, pues, hay una manera muy fácil de evitar que lo escuchen a uno cuando esta haciendo sus prácticas. Poner vuestro radio, sintonizar una estación pero con el volumen alto y entonces el sonido del radio evitará que las gentes profanas puedan escucharlos.
Así hay que hacer en la vida moderna y porque como nosotros vivimos una vida tan artificiosa, no estamos en las épocas aquellas de la India, del Tibet o de la antigua Jerusalén en que cada cual podía hacer sus prácticas sin que a los demás les interesara un comino lo que uno estaba haciendo.
Ahora hermanos hay que sabernos manejar lo mejor posible dentro de este ambiente tan rudo en que vivimos.
Pasemos hermanos a estudiar ahora.

Sabed que la Clariaudiencia es la facultad que nos permite a nosotros escuchar el ultra, oír en el ultra.
El hombre que desarrolla la clariaudiencia puede escuchar las voces de los desencarnados, las voces de los Angeles, de los Tronos, de los Querubines, de los Serafines, etc., etc.
Esta maravillosa facultad está exactamente sobre la glándula tiroides. La glándula tiroides está en la laringe, es una glandulita muy importante, secreta el yodo biológico. En esa glándula hay un chakra maravilloso, un chakra que al ser despertado nos confiere el poder de oír en el ultra.
Los mantrams para el despertar de la clariaudiencia son muchos; voy a enseñarles algunos.
En todo caso empecemos por la «E». Sabed vosotros que la «E» es el fundamento de todos los mantrams relacionados con la clariaudiencia y la letra «E» se vocaliza así.
Esta es la letra fundamental de la clariau diencia. Ahora voy a enseñarles algunos mantrams para el desarrollo de esa facultad.
Empecemos con el siguiente:
Este mantram se vocaliza así:
Este mantram es maravilloso, su vibración es formidable. Con éstos mantrams lograréis el desarrollo de la clariaudiencia.
Lograd la clariaudiencia mis caros hermanos. Es necesario que aprendáis a oír, repito, en los mundos superiores. Sed constantes y vocalizad siempre los mantrams hasta lograr el desarrollo de vuestras facultades superlativas trascendentales.
Otra manera también bastante importante para el desarrollo de la clariaudiencia ha sido siempre el mantrams y la meditación sabiamente combinados con la oración y la entonación de las dos letras E y N, así:
Si vocalizáis combinando la meditación con la oración obtendréis el desarrollo de vuestras facultades en muy poco tiempo.
Veamos ahora mis caros hermanos el asunto aquel de:

¿Qué se entiende por Intuir? Voy a decirles. La intuición nos confiere el poder de saber sin la necesidad del proceso deprimente de la razón. Ejemplo: esto es blanco por aquello, etc.
En la intuición se pone el corazón, el chakra del corazón nos da la preciosa facultad de la Intuición. El mantrams para el desarrollo de la intuición es el sagrado «OM». Esa sílaba se pronuncia así:
Como veis la O es una letra muy vital del centro del corazón.
Bien ahora voy a enseñarles los mantrams del corazón. Empecemos con la vocal «O». Se inhala bien el oxígeno por la nariz y luego se exhala lentamente articulando la letra «O» así:
Vocalizad intensamente hermanos, vocalizad ésta vez para que logréis vosotros el despertar de la facultad intuitiva. Podéis combinar la «O» con la «N» así:
Así entonces daréis a la vocal «O» un sonido acampanado, esa es la virtud de la «N», darle cierto sonido acampanado a las vocales.
Sabed que la imaginación, la oración, la meditación, la contemplación, son los caminos que nos llevan a la intuición; no os canséis de estar vocalizando.
Pasemos ahora hermanos a estudiar:

Cuantas veces vais vosotros por la calle y de pronto veis a una persona en la cual estabais pensando hace algunos minutos. No hay duda de que telepaticamente ya os habíais comunicado con esa persona.
La telepatía nos permite a nosotros captar los pensamientos de las gentes a distancias, es una facultad muy interesante de verdad.
Si queréis vosotros desarrollar la telepatía debéis saber que el fundamento de la telepatía está en el chakra... y ese chakra se haya situado exactamente arriba del ombligo. El chakra relacionado con la telepatía es el plexo solar.
El plexo solar existe realmente en el organismo humano como les digo, está situado un poquito arriba del ombligo. Hay muchos ejercicios para el desarrollo de la telepatía; voy a enseñaros dos.
En un cómodo sillón, relajados profundamente frente al oriente, imaginarán radiaciones en el plexo solar. Imaginar que el plexo solar es una flor de loto que está girando de izquierda a derecha, no desmayéis en ésta práctica. Imaginad que los rayos son de un bello color azul y dorado, sentid en vuestro plexo solar toda la sensación de esos rayos inefables.
Practicad sin cansaros; con media hora es suficiente. Ese es el primer ejercicio mis caros hermanos.
El segundo consiste en concentrarnos intensamente en el plexo solar y vocalizar la «U» así:
Podéis añadirle también a ésta vocal la letra «N» para tener un sonido acampanado, así:
Haced vuestras prácticas con intensidad, no descanséis, lo importante es que no os canséis hermanos. Es necesaria la constancia, la tenacidad. Son muchos los hermanos que comienzan a hacer estas prácticas y que luego se cansan.
Si tu quiere verdaderamente desarrollar tus poderes no te canses, hay que ser tenaz, muy tenaz. Sin tenacidad mis caros hermanos es completamente imposible lograr el despertar de las facultades superiores del alma.
Les estamos dando los Mantrams que se necesitan para el despertar de los poderes; pero si vosotros no sois tenaces, pues, realmente estamos perdiendo el tiempo. Lo que se requiere es que vosotros practiquéis... ¿Entendido?.
Ahora mis caros hermanos vamos a analizar lo que es aquello de las reencarnaciones pasadas.

Claro, tu que estáis estudiando estas enseñanzas ya habéis leído nuestras obras, dique que ya habéis estudiado: El Matrimonio Perfecto, La Revolución de Bel, El Curso Zodiacal, La Rosa Ignea, nuestro tratado de Endocrinología y Criminología, etc. Y si no lo has estudiado hermano todavía, te aconsejo que los estudies.
La reencarnación es un hecho. Para unos la reencarnación puede ser teoría, para otros puede ser superstición, para otros una creencia a lo que sea; pero para los que ya recordamos nuestras vidas pasadas, la reencarnación es un hecho.
Juan el Bautista era el profeta Elías; es el ejemplo citado en los evangelios sobre reencarnación.
Uno puede recordar sus vidas pasadas si despierta los chakras pulmonares. Tanto en el pulmón derecho como en el izquierdo hay centros magnéticos. Los dos chakras pulmonares son maravillosos y despertando esos chakras podréis tú, hermano mío, recordar con exactitud tus pasadas reencarnaciones.
La vocal «A» hace vibrar los chakras pulmonares; se vocaliza así:
¿Comprendido?. Si queréis añadirle la «N», tanto mejor, porque le dais a la vocal un sonido acampanado. En ese caso vocalizaríais así:
Ya veis hermanos, ¿qué fácil?. Hacerlo vosotros por allí también.

Libro Amarillo.
El Poder de los Mantrams.

Por: V.M. Samael Aun Weor
 El hombre es un trío de Cuerpo, Alma y Espíritu. El alma es el mediador entre el espíritu y el cuerpo. Un alma se tiene, un Espíritu se es. El Intimo es el Altísimo dentro de nosotros. El Intimo es el espíritu. El testamento de la sabiduría dice; "Antes de que la falsa aurora apareciera sobre la tierra, aquellos que sobrevivieron al huracán y a la tormenta alabaron al Intimo, y a ellos se les aparecieron los heraldos de la aurora. Entre el hombre terrenal y el Intimo está el alma. El alma tiene un cuerpo ultrasensible y material con el cual viaja a través del espacio. El cuerpo del alma es el cuerpo astral. Así pues el cuerpo astral tiene algo de humano y algo de divino.
El cuerpo astral tiene su ultra fisiología y su ultra-patología íntimamente relacionadas con el sistema nervioso gran simpático y con nuestras glándulas de secreción interna. El cuerpo astral está dotado de maravillosos sentidos con los cuales podemos investigar los grandes misterios de la vida y de la muerte.
Dentro del astral está la mente, la voluntad y la conciencia.
Nuestros discípulos deben aprender a salir en cuerpo astral.
Esto que estamos enseñando en este capítulo es una tremenda realidad. Desgraciadamente los hermanos de todas las escuelas espiritualistas ignoran totalmente el uso y manejo del cuerpo astral.   
A nosotros nos da dolor ver a los hermanos de las distintas organizaciones tan ignorantes sobre el uso y manejo del cuerpo astral.
Los hermanos de las distintas escuelas espiritualistas viven  en el astral con conciencia dormida. Cuando un hermano entra en la senda, los tenebrosos del sendero lunar suelen atacarlo durante el sueño. Los hermanos de la sombra asumen la figura del Gurú para extraviar a los discípulos. Ahora debemos comprender que es un delito no enseñar a los discípulos el uso y manejo práctico del cuerpo astral. Es necesario que los discípulos despierten su conciencia durante el sueño para que puedan defenderse de los ataques tenebrosos.
Hacerse consciente del proceso del sueño no es peligroso. Nosotros debemos hacer conciencia de todas nuestras funciones  naturales.
            Existe un estado de transición entre la vigilia y el sueño. Todo ser humano se sale del cuerpo en ese instante involuntariamente. Poniendo atención, podemos salimos voluntaria y conscientemente en ese instante de transición que existe entre la vigilia y el sueño. Lo importante es vigilar el sueño. Entonces podemos levantarnos del lecho y salir de nuestra casa rumbo a la Iglesia Gnóstica. En la Iglesia Gnóstica oficia nuestro Señor El Cristo.

Todo lo que tienen que hacer los discípulos es vigilar el sueño y levantarse del lecho en instantes de estar dormitando. La explicación que damos debe traducirse en hechos. Los que han leído mucho suponen erradamente que la cuestión es mental, piensan que deben levantarse mentalmente. Repetimos que esto debe traducirse en hechos. Hay que levantarse con tanta naturalidad como lo hacemos por las mañanas.
No es peligroso salir del cuerpo astral porque todo el mundo sale en cuerpo astral durante el sueño. El que quiera despertar la conciencia durante el sueño, debe conocer la clave del discernimiento.                                            
Durante el sueño todo ser humano anda en los mundos internos con la conciencia dormida. El alma envuelta en su cuerpo astral abandona el cuerpo físico durante el sueño. Así es como el cuerpo Etérico puede reparar el cuerpo denso.
Cuando el alma entra al cuerpo, entonces despertamos del sueño natural. En los mundos internos las almas se ocupan en los mismos oficios cotidianos. Entonces compran y venden como en el mundo físico. Las almas de los vivos y de los muertos conviven juntas durante el sueño. En los mundos internos todo lo vemos como en el mundo físico. El mismo sol, las mismas nubes, las mismas casas de la ciudad, todo igual.
Ahora entenderán nuestros discípulos Gnósticos porque los muertos no aceptan que estén muertos. Ahora comprenderán nuestros discípulos por qué las almas de los vivos compran y venden, trabajan, etc., durante el sueño. Saliendo en cuerpo astral conocemos los misterios de la vida y de la muerte. Todo ser humano sale en cuerpo astral durante el sueño. Despertando la conciencia durante el sueño normal, podemos conocer los grandes misterios de la vida y de la muerte. Para  despertar la conciencia durante el sueño, existe una clave. La clave para despertar la conciencia es la del discernimiento.
Veamos: si vais por una calle y os encontráis con un amigo, o veis objetos que os llamen la atención, da un saltito con la intención de flotar: es lógico que si flotáis, es porque andáis fuera del cuerpo físico. Empero si no flotáis, es porque estáis en cuerpo físico.
Sucede que en los mundos internos actuamos durante el sueño lo mismo que en carne y hueso, y si a esto se añade que allí todo lo vemos lo mismo que aquí en el mundo físico, entonces comprenderemos que solo si logramos volar despertaremos la conciencia para darnos cuenta que estamos en cuerpo astral.
Este ejercicio se practica a cada instante durante el estado de vigilia, en presencia de toda cosa curiosa. Lo que se hace en vigilia, se repite durante el sueño. Si hacemos esta práctica durante el sueño, el resultado, será que al saltar quedamos flotando en cuerpo astral. Entonces despertará nuestra conciencia y llenos de felicidad diremos, estoy en cuerpo astral.
Así podremos dirigirnos a la Santa Iglesia Gnóstica para conversar personalmente con los Ángeles, Arcángeles, Serafines, Profetas, Maestros, etc. Así podremos recibir instrucción de los grandes maestros de la Logia Blanca. Así podremos viajar en cuerpo astral a través del infinito.
No necesitamos destruir la mente con tantos libros y teorías. En los mundos internos podemos recibir la enseñanza de los maestros. Al despertar del sueño natural, los discípulos deben esforzarse por recordar todo lo que vieron y oyeron durante el sueño.
Es necesario que nuestros discípulos aprendan a interpretar sus experiencias internas.
Estudiando el libro de Daniel en la Biblia, podrán aprender a interpretar sus experiencias internas.
"El Sueño y la Memoria" son los poderes que nos permiten conocer los grandes misterios de la vida y de la muerte.
Los sueños son las "Experiencias Astrales".
Los sueños son verdaderos.
El Chac Mool
El Chac Mool del México azteca es maravilloso. Realmente el Chac Mool existió; fue un Adepto encarnado, uno de los grandes Iniciados de la poderosa civilización serpentina del antiguo México y de la gran Tenochtitlán.                                                                             

El sepulcro del Chac Mool fue hallado y sus restos encontrados. Así está fuera de toda duda de que el Chac Mool existió realmente. Si se observa la figura en que está acostado el Chac Mool, veremos que está acostado en la misma posición en que se acostaban los Iniciados egipcios cuando querían salir en Cuerpo Astral pronunciando el mantram FA-RA-ON. Empero, algo curioso aparece en el ombligo del Chac Mool: es una escudilla o recipiente como para recibir algo. Realmente el plexo solar es maravilloso y el Chac Mool le dejó a la humanidad una gran enseñanza.
El Kundalini o Serpiente Ignea de nuestros mágicos poderes tiene un gran depósito de energía solar en la región del ombligo, en el chacra del plexo solar. Este centro magnético es muy importante en la Iniciación, porque es él quien recibe la energía primaria que se subdivide en diez radiaciones, esplendorosas. Dicha energía primaria circula por los canales nerviosos secundarios animando y alimentando a todos los chacras. El plexo solar está gobernado por el sol. Si el estudiante quiere tener una vigorosa clarividencia realmente objetiva en el sentido más completo de la palabra, debe aprender a llevar la energía solar desde su depósito del plexo solar, hasta el chacra frontal. El mantram SUI-RA es la clave que nos permite extraer energía solar del plexo del sol para llevarla al centro frontal. Vocalícese así: SUIIIIIIIII RAAAAAAAAA. Una hora diaria, el resultado será el despertar del chacra frontal en forma positiva. Si queremos fuerza solar para el chacra laríngeo, vocalizaremos el mantram SUE-RA así: SUEEEEEEEE RAAAAAAAA. Si necesitamos energía solar para el loto del corazón vocalizaremos el mantram SUO-RA así: SUOOOOOOOO RAAAAAAAA. Todo se resume en el gran SUA-RA, donde según los Vedas y los Sastras se encuentra el silencioso Gandarva (músico celeste). Es necesario saber utilizar la energía solar depositada en el plexo solar. Conviene que los aspirantes a la Iniciación se acuesten en decúbito dorsal, los pies sobre la cama, rodillas levantadas. (Véase figura del Chac Mool). Es claro que al poner las plantas de los pies sobre la cama, las rodillas quedan levantadas, dirigidas hacia el cielo, hacia Urania.
El aspirante en esta posición se imaginará que la energía del sol penetra por su plexo solar haciendo vibrar y rotar de izquierda a derecha como las manecillas de un reloj cuando lo miramos de frente. Este ejercicio puede hacerse una hora diaria. El mantram básico de este centro magnético es la vocal U. Esta vocal se puede vocalizar alargando el sonido así: UUUUUUUU. Un plexo solar bien despierto anima a todos los chacras del organismo maravillosamente. Así nos preparamos para la Iniciación.
El Chac Mool fue venerado por el México serpentino. Dos castas guerreras lo adoraban. El Chac Mool era llevado en grandes procesiones y entraba en los templos aztecas adorado por las multitudes. A él también se le hacían rogativas pidiéndole lluvias para la tierra. Este gran Maestro ayuda a los que le invocan. Podrían hacerse amuletos con la figura del Chac Mool para cargarlos al cuello en forma de medallón, o pequeñas esculturas del Chac Mool.
Clave para salir en astral conscientemente.
La clave para salir en astral es muy sencilla. Basta adormecerse pronunciando mentalmente el poderoso mantram FARAON. Este mantram se divide en tres sílabas: FA-RA-ON. Cuando el devoto se halla ya en ese estado de transición que existe entre la vigilia y el sueño, se adentrará dentro de sí mismo por medio de la autorreflexión consciente, y luego suavemente saltará de su cama completamente identificado con su espíritu suave y fluídico. En Cuerpo Astral todo devoto puede concurrir al “Pretor”. Las personas que no han engendrado todavía el Astral Cristo, sufren mucho porque no logran aprender a salir en Astral, sino con millares de penalidades y después de muchísimo trabajar. Aquellos que en pasadas reencarnaciones engendraron el Astral Cristo, salen del cuerpo físico con suma facilidad.
            La Sutil Voz
Existe un místico sonido que el yogui debe aprender a escuchar. Los Aztecas conocieron ese místico sonido. Recordemos el cerro de Chapultepek. Un Códice mexicano representa sobre el cerro a un grillo. En la Roma Antigua de los Césares el grillo era vendido entre jaulas de oro a precios elevadísimos. Los magos de la antigua Roma compraban ese animalito para emplearlo en la Magia Práctica.
Si tenemos ese animalito cerca, a la cabecera de la cama, y si meditamos en su canto delicioso, entonces escucharemos la sutil voz en instantes de estar dormitando. Este fenómeno es semejante al de dos pianos igualmente afinados. Sí tocamos por ejemplo, la nota SI de cualquiera de los dos pianos, en el otro piano se repite la misma nota sin que mano humana la toque. Este es un fenómeno vibratorio muy interesante que cualquiera puede comprobar. Cosa exacta sucede con el canto misterioso del grillo. Dentro del cerebro humano existe el místico sonido que resuena cuando el animalito canta. Es cuestión de afinidad y vibración.
No es problema la alimentación de ese animalito, sabemos que se alimenta de vegetales, también se come la ropa en las casas de familia, y la gente le teme porque nadie quiere perder su ropa. Cualquiera puede conseguir ese animalito en el monte.
Aquel que sabe escuchar la sutil voz, puede salir instantáneamente en cuerpo astral cada vez que quiera. Si el devoto se concentra en el canto del grillo..., si el yogui medita en el canto del grillo..., si el yogui se adormece escuchando ese canto, pronto resonará dentro de su cerebro el mismo canto, el místico sonido, la sutil voz. Entonces las puertas del misterio están abiertas. En esos instantes puede el Gnóstico levantarse de su lecho con toda naturalidad y salir de su casa en cuerpo astral.
No se trata de levantarse con la mente, lo que estamos diciendo debe traducirse en hechos. Levántese el devoto, levántese de su cama con entera naturalidad que la naturaleza se encargará en esos instantes de separar el cuerpo astral del cuerpo físico.
Fuera del cuerpo físico sentimos una voluptuosidad espiritual deliciosa. No hay mayor placer que aquel de sentirse el alma desprendida. En los mundos superiores podemos platicar con los Dioses Inefables. En los mundos superiores podemos estudiar a los pies del Maestro. Así nos libertamos de tanta teoría, así bebemos en la fuente viva del conocimiento.
Todo devoto debe aprender a escuchar la sutil voz. Con el místico sonido, el devoto puede realizar maravillas y prodigios.
Si el devoto quiere escuchar el místico sonido, su concentración debe ser perfecta. Al principio el estudiante escuchará muchos sonidos, pero si se concentra con intensidad en el canto del grillo, al fin logrará escucharlo. Entonces habrá Victoria. Con el místico sonido llegamos inevitablemente a la Iluminación.
El místico sonido en última síntesis procede del corazón tranquilo. El origen remoto del místico sonido debemos buscarlo en la Madre Divina. El devoto debe orar mucho rogándole a la Divina Madre, que le conceda la gracia de escuchar el místico sonido.
Con la gracia de la Madre Divina todo devoto puede tener la dicha de escuchar el místico sonido que nos permite la salida instantánea en cuerpo astral.
El devoto que quiera realizar con éxito estas prácticas debe entregarse a la meditación interna cuando verdaderamente se sienta con bastante sueño. Sabed que todo ejercicio esotérico de meditación con ausencia del factor sueño, es dañoso, inútil, estéril, daña la mente y arruina el cerebro.
La meditación interna debe combinarse inteligentemente con el sueño.
Si el estudiante Gnóstico desafortunadamente no tiene en su poder el maravilloso animalito mencionado en este capítulo, entonces debe hacer resonar la letra S, así: Sssssssss, como un silbo muy fino y delicado (labios entreabiertos y los dientes de arriba tocándose con los dientes de abajo) detrás de ese finísimo sonido, se halla la sutil voz que nos permite la salida instantánea en cuerpo astral.
V.M. Samael Aun Weor

Puerta de Entrada a la Iniciación.
Misterios Mayores.
Libro Amarillo.

Por: V.M. Samael Aun Weor
Estado de Jinas
El Hiperespacio puede ser demostrado matemáticamente con la Hipergeometría. La ciencia Jinas pertenece al Hiperespacio y a la Hipergeometría.
 Si conocemos el volumen, tenemos que aceptar también el Hipervolumen como base fundamental del volumen. Si aceptamos la esfera geométrica debemos aceptar también la Hiperesfera.
El Hiperespacio permite a los Gnósticos realizar actos extraordinarios: Jesús pudo sacar su cuerpo de entre el sepulcro a los tres días, gracias al Hiperespacio. Desde entonces el Maestro Resucitado vive con su cuerpo dentro del Hiperespacio.
Todo Iniciado que recibe el Elixir de larga vida muere pero no muere. Al tercer día se escapa del sepulcro utilizando el Hiperespacio. Entonces el sepulcro queda vacío.
La desaparición o aparición de un cuerpo en el espacio objetivo tridimensional, o el paso de una persona a través de un muro se realizan con pleno éxito cuando se utiliza científicamente el Hiperespacio.
Los Gnósticos científicos colocan su cuerpo físico en "Estado de Jinas" y se mueven conscientemente en el Hiperespacio.
Cuando el cuerpo del Yogui se mete en el Hiperespacio, decimos que se encuentra en estado de Jinas.
El Yogui en estado Jinas, puede pasar por entre el fuego sin quemarse, puede caminar por sobre las aguas como lo hizo Jesús, puede flotar en los aires. Puede atravesar una roca o un muro de lado a lado sin recibir ningún daño.
La Ciencia de Jinas se fundamenta en el Hiperespacio y es una rama especial de la Física Atómica.

Las personas ignorantes que jamás en la vida han estudiado Hipergeometría, niegan los estados de Jinas. Esa clase de gentes son dignas de piedad porque son ignorantes.
La vieja Geometría se fundamenta en la Hipótesis absurda de que por un punto en un plano se puede con seguridad completa trazar una paralela o una recta, pero solamente Una (hablando en sentido esencial).
El Movimiento Gnóstico rechaza el punto de vista Euclidiano de las tres conocidas dimensiones, por estar ya totalmente anticuado para la era atómica.
La llamada Paralela Única (suspendiéndose en el Sentido Espacial Absoluto) se multiplica dentro de las distintas dimensiones del Hiperespacio. Entonces ya no es única.
La Paralela Única de Euclides es un sofisma para atrapar gente ignorante. La Gnosis rechaza esa clase de sofismas.
El Movimiento Gnóstico Revolucionario no puede aceptar el postulado indemostrable que dice: "Por un punto cualquiera de nuestra Mente se puede trazar una Paralela Real, a la Realidad Visible y solamente Una".
La Paralela Unica no existe. El espacio tridimensional Absoluto y Dogmático del Geómetra Euclides, es indemostrable y falso.
La afirmación absurda de que el mundo físico de experimentación es el único real, resulta ser una razón muy corrida de los ignorantes ilustrados que jamás han investigado los Campos Electromagnéticos, y la llamada Promateria como causa causorum de la materia física.
La cuarta dimensión es Hiperespacial. Los Gnósticos tienen sistemas especiales para meter su cuerpo físico dentro del Hiperespacio. No importa que los ignorantes se rían de los estados de Jinas. El que ríe de lo que desconoce está en camino de ser idiota. Realmente sólo el idiota ríe y ríe de lo que no conoce.
Los Gnósticos afirmamos que el espacio infinito interplanetario es curvo. Afirmamos que el infinito vive en incesante movimiento. Afirmamos que existe una serie infinita de espacios giratorios de distintas dimensiones que se penetran y compenetran mutuamente sin fundirse. Afirmamos que todos esos espacios del infinito estrellado tienen forma Hiper-elipsoidal. Afirmamos que con la fuerza de la mente el hombre puede meter su cuerpo físico dentro de cualquier espacio giratorio Hiper-elipsoidal. Afirmamos rotundamente que la Astrofísica revolucionaria demostrará al mundo la existencia del Hiperespacio. Afirmamos que dentro de una línea existen otras Hiperespaciales.
Afirmamos que El Salvador del mundo vive actualmente en el Hiperespacio con el mismo cuerpo que tuvo en la tierra santa. Afirmamos que todo Iniciado que recibe el elixir de la larga vida, muere pero no muere. Afirmamos que todos aquellos que reciben el elixir de la larga vida, se escapan con su cuerpo físico al tercer día aprovechando la oportunidad que nos brinda el Hiperespacio. Estos conservan su cuerpo físico durante millones de años. El inmortal Babají y su hermana Matají conservan su cuerpo desde hace muchos millones de años y cumplirán una gran misión con la humanidad de la futura sexta y séptima Grandes Razas. Afirmamos rotundamente que todo el que trabaje con el Arcano A.Z.F. puede pedir el Elixir de Larga Vida. Esos mueren pero no mueren. Afirmamos que todo ser humano puede poner su cuerpo físico en estado de Jinas en el instante que quiera, si verdaderamente tiene fe en la Divina Madre. Todo sabio del Aire Elemental puede dar el gran salto. Los maestros de la ciencia Jinas pueden fugarse de la tierra para vivir en otro planeta con el cuerpo físico que aquí tienen. Ellos pueden llevarse ese cuerpo de carne y hueso para otro planeta. Ese es el gran Salto. Algunos hombres de la ciencia Jinas, ya dieron el gran salto. Con el Pranayama se logra el poder que nos permite poner el cuerpo físico en estado de Jinas. Existen muchas claves para poner el cuerpo físico en estado de Jinas. Es urgente practicar el pranayama, antes de usar esas claves. Resulta interesante que los testigos Ida y Pingalá, en última síntesis tienen sus raíces en los testículos derecho e izquierdo del varón, y en los ovarios de la mujer. Por ese par de canales nerviosos suben los átomos Solares y Lunares del sistema seminal, hasta el Cáliz (El cerebro). Las dos fosas nasales y los órganos sexuales se hallan conectados mediante los dos testigos. Esto nos invita a reflexionar. Realmente el Pranayama es entre otras cosas, un sistema de transmutación sexual para los solteros.
Todo Gnóstico debe empezar sus prácticas Jinas después de haberse preparado intensamente con el Pranayama. Los grandes maestros de la Yoga, flotan en el aire cuando están practicando Pranayama. Sólo puede flotar en el aire el cuerpo que se escapa de la ley de Gravedad. Sólo puede escaparse de esa ley, el cuerpo que se mete dentro del Hiperespacio.
Con la fuerza mental conscientemente manejada, podemos meter el cuerpo físico dentro del Hiperespacio. La ciencia Jinas es cuestión de Vibración. Por encima y por debajo de los límites de percepción objetiva existen mundos colocados en otras dimensiones. Con la fuerza del pensamiento podemos mediante ciertas claves de la ciencia Jinas que a continuación damos, acelerar la frecuencia oscilatoria y vibración normal del cuerpo físico. Entonces penetramos con el cuerpo dentro del Hiperespacio. Cuando los científicos logren el control absoluto del movimiento atómico, podrán poner cualquier cuerpo dentro del Hiperespacio. Los devotos de la religión Jinas antes de sus prácticas con el Pranayama, deben orar a la Divina Madre suplicándole que les dé el poder de poner el cuerpo físico en estado de Jinas. Se debe practicar muchísimo Pranayama para conquistar los poderes de Jinas. El estudiante debe seleccionar cuidadosamente la clave que más guste para practicar la ciencia Jinas. Es urgente que el estudiante comprenda que la religión Jinas exige castidad absoluta y suprema santidad.
Recordad bien amado Discípulo que los poderes Divinos de la ciencia Jinas son muy sagrados. Estos poderes sólo se pueden utilizar para sanar enfermos a distancia, para curar, para entrar en los templos de la Logia Blanca, para estudiar las maravillas de la creación entre el seno de la Naturaleza.
Todo aquel que intente hacer uso egoísta de los poderes Jinas, se convertirá en un horrible Demonio, y rodará inevitablemente al abismo.
Ley es Ley. El Karma castiga a los abusadores.
El devoto debe escoger la clave Jinas que más le guste, y practicar con ella diariamente, intensamente hasta lograr la victoria.
Esta ciencia no es para los débiles, ni para la gente versátil, voluble, inconstante. Esta ciencia es para la gente que tenga tanta paciencia como la del Santo Job. Esta ciencia es para gente tenaz, incansable, valerosa, firme como el acero.
Esta ciencia no es para gente escéptica; ésas personas no sirven para la ciencia Jinas.
Esta ciencia no se puede exhibir jamás porque la Logia Blanca lo prohibe. La ciencia de los Jinas no es cuestión de prestidigitación, ilusionismo o cosa por el estilo. Esta ciencia es terriblemente divina y sólo se practica en secreto. Cuando el autor de este libro quiso hacer demostración pública de la ciencia Jinas intervino instantáneamente el Maestro Moria, diciendo: "Hace diez años que te estamos ayudando y ¿ahora quieres exhibir tus poderes?". Los poderes son muy sagrados. Los poderes no se deben exhibir en público. Desde entonces comprendimos que la ciencia Jinas es secreta.
Muchos quisieran demostraciones. Nosotros, los hermanos del Templo no somos conejos de laboratorio. Real es aquello que uno mismo experimenta. Nadie puede experimentar en pellejo ajeno.
Nosotros damos la clave para que cada cual experimente en su propio pellejo. A la gente que está llena de dudas, a los escépticos, les aconsejamos que no se metan en estos estudios porque se pueden volver locos. El batallar de antítesis tremendas pueden desquiciar el cerebro de los escépticos y conducirlos al manicomio. La ciencia Jinas es para la gente que tenga una fe inquebrantable como el acero. Esto no es para personas llenas de dudas.
 Van a continuación las claves Jinas para la gente llena de fe.
 Primera Clave
Acuéstese el devoto de lado izquierdo. Apoye la cabeza sobre la palma de la mano izquierda. Adormézcase el devoto, vigile su propio sueño, conviértase en un vigilante de su propio sueño.
Cuando el devoto comience a ver las visiones propias del ensueño, levántese muy despacio de su cama, pero conservando el sueño como un tesoro precioso. Antes de salir de su casa el devoto debe dar un saltito con la intención de quedar flotando en el ambiente circundante. Si al dar el saltito el devoto flota sobre el ambiente, es porque su cuerpo físico entró en estado de Jinas. Si el devoto no flota, es porque no está en estado de Jinas. Cuando el devoto se halla en estado de Jinas, puede salir de su casa con toda confianza, sin temor ninguno. En estado de Jinas pueden los devotos viajar a los lugares más remotos de la tierra en pocos instantes.
Si el devoto fracasa en el experimento, si no logra en el primer momento el estado de Jinas, no debe desalentarse, métase entre su cama y repita el experimento tantas veces cuantas horas y minutos tenga la noche. Algunos logran el triunfo inmediatamente, esos son los afortunados, aquellos que practicaron la ciencia Jinas en antiguas reencarnaciones. Otros nunca han practicado esa ciencia y tienen que empezar por lograr ese poder practicando Pranayama y ejercitándose durante varios años hasta lograr los poderes Jinas.
Realmente esta clave resulta una modificación del sonambulismo, un sonambulismo voluntario, provocado.
Durante el sueño funcionan tremendas energías subconscientes que el devoto debe aprovechar como palanca para meter su cuerpo dentro del Hiperespacio.
Segunda Clave Jinas
Existe una almendra muy común, llamada vulgarmente Ojo de Venado.
Esa almendra tiene maravillosos poderes Jinas. El devoto debe adormecerse teniendo en su mano esa almendra. Colóquese el devoto en la misma postura de la clave anterior, pero conservando en su mano derecha la maravillosa almendra. Es urgente recordar que esa almendra tiene un genio Elemental maravilloso que puede ayudar al devoto a poner su cuerpo en estado de Jinas.
Durante esta práctica debe el devoto adormecerse pronunciando el mantram Invia. Entonces concurrirá un genio elemental que le ayudará a poner el cuerpo en estado de Jinas.
El devoto debe levantarse de su cama conservando el sueño como oro puro. Antes de salir de casa, el devoto debe dar un saltito con la intención de flotar en el ambiente. Si el devoto flota puede salir de su casa en estado de Jinas. Si no flotare, repita el experimento horas o meses, o años hasta lograr la victoria.
Tercera Clave
Existe un Maestro cuyo nombre es Oguara. Este Jinas ayuda realmente a todos aquellos que lo llaman en nombre del Cristo. El devoto se acostará en la misma posición anterior, pero llamando al Jinas Oguara en nombre de Cristo, diciendo: en nombre del Cristo, por la majestad del Cristo, por el poder del Cristo, yo te llamo Oguara, Oguara, Oguara. Poned mi cuerpo en estado de Jinas. Repítase esta invocación muchísimas veces hasta entrar en sueño, luego levántese el estudiante conservando el sueño como oro puro. Dé el devoto un saltito con la intención de flotar en el espacio. Si flota es porque ya está en estado de Jinas. Si no flota métase entre el lecho y repítase el experimento.
Cuarta Clave
Siéntese el devoto ante una mesa. Posición de brazos cruzados sobre la mesa. Adormézcase el devoto con la cabeza apoyada sobre sus brazos cruzados. Debe el devoto invocar a los Maestros Jinas para que le ayuden en estas prácticas. Puede llamarse a Babají (el Cristo Yogui de la India) o a su hermana Matají. Puede invocarse a Harpócrates o a San Pedro, etc. Cuando ya el estudiante comience a soñar, levántese de la silla, sin hacerse razonamientos de ninguna especie, automáticamente, instintivamente y conservando el sueño como oro puro. Entonces el estudiante debe dar un salto lo más largo que pueda con la intención de flotar en el espacio. El devoto debe marcar en el suelo con un lápiz, el sitio exacto hasta donde llegó el salto. Diariamente el estudiante debe repetir el experimento incansablemente, pacientemente, pintando siempre una raya en el suelo con un lápiz para marcar el largo de cada salto. Este sistema es maravilloso porque el estudiante Jinas va apreciando sus grados de progreso Jinas. Puede que su salto hoy haya sido un metro de largo; mañana puede haber aumentado un centímetro, pasado mañana otro centímetro, etc., así el estudiante va midiendo con exactitud su progreso Jinas. Al fin notará con asombro un buen día, que ha dado un salto demasiado largo, un salto extraño, que ningún atleta puede dar; estas señales le indican claramente su progreso en la ciencia Jinas. Después de semejante extraño salto, ya el devoto podrá quedar flotando en el Hiperespacio, ha alcanzado la Victoria. Esta clave es formidable. Lo importante en el ocultismo es la práctica. Ya la gente está cansada de teorías; ahora se necesita ocultismo práctico. Los teorizantes, ni hacen ni dejan hacer. El estudiante no debe perder el tiempo teorizando. Es mejor practicar callado. Guardar en secreto los triunfos. Se debe guardar mucho silencio porque  esta ciencia es secreta. Es mejor callar. Así nos evitamos las burlas de los teorizantes inútiles, que ni hacen ni dejan hacer, esos son parásitos sociales.
Quinta Clave
En el preciso instante de despertar del sueño normal puede el estudiante saltar de su cama instantáneamente, sin análisis consciente ni subconsciente; sin el proceso de elección conceptual, en forma instintiva, extasiado por la sabiduría y lleno de una fe tan fuerte como el acero de una espada muy bien templada y lista para la batalla.
Antes de salir de la casa debe el estudiante saltar entonces, y si flota en el ambiente, es porque su cuerpo ya entró en estado de Jinas. Entonces el estudiante puede dirigirse a donde quiera con su cuerpo físico en estado de Jinas.
Si no flotare debe el estudiante repetir el experimento. Con paciencia se anda muy lejos en estos estudios.
Sexta Clave
Los caballeros tigres del México Azteca ponían su cuerpo físico en estado de Jinas con ayuda de la fuerza elemental del tigre.
Algunos Códices Mexicanos nos pintan a los caballeros tigres dirigiéndose al templo en figura de tigre. Dícese que cuando llegaban al templo tomaban nuevamente figura humana.
En el México antiguo, el templo de los tigres era muy sagrado. La fuerza elemental del tigre permite poner el cuerpo en estado de Jinas. El estudiante puede acostarse sobre una piel de tigre. Adormézcase el devoto invocando a los Devas que reinan sobre los tigres. Suplíqueseles que nos ayuden con la fuerza del tigre.
Los devotos aztecas de la orden sagrada de los tigres, se identificaban con el tigre, se adormecían, y luego conservando el sueño como oro puro, se levantaban de su lecho andando en cuatro patas como el tigre. Entonces decían llenos de fe: nosotros nos pertenecemos.

Así con el cuerpo en Jinas y con figura de tigre llegaban los caballeros Tigres al templo. Los Códices Mexicanos nos dicen que allí tomaban nuevamente su figura humana.
Los Yoguis del Indostán se sientan a meditar sentados sobre una piel de Tigre.
Cuentan los Aztecas que la primera raza humana fue devorada por los tigres (símbolo de la fuerza divina).
 "Que soles de entusiasmo os alumbren el camino".
"Que la Xhcoc cante a vuestro paso".
"Que las fuerzas del tigre os acompañen".
"Que los cocuyos de sabiduría iluminen vuestro intelecto".
"Que el Picr rumoroso, dé sombra a vuestros descansos".
"Que las ranas de esmeralda señalen los senderos, croando sin descanso".
"Que ella, la Naturaleza, sea pródiga con vosotros".
"Que la fuerza universal nos bendiga y dirija".
El Yogui Occidental acostado sobre la piel de tigre y con el cuerpo semidesnudo debe hacer la práctica esotérica de los caballeros tigres. Así podrá entrar en estado de Jinas.
Séptima Clave
Aquellos que saben salir en cuerpo astral, pueden invocar su cuerpo desde lejos. Lo primero que hace el Gnóstico que va a trabajar con esta clave, es salirse en cuerpo astral. Cuando ya se halla lejos de su cuerpo puede llamar a cualquiera de los Maestros Jinas y suplicarle que le traiga su cuerpo, puede invocarse a Harpócrates, Babají, Matají, San Pedro, Oguara, etc. Se ruega por el Cristo, se pide por el Cristo, se suplica por el poder del Cristo. Entonces los genios Jinas, sacan el cuerpo de la cama, y lo traen al devoto que lo pide.
Antes de llegar el cuerpo ante el devoto, se ven primero unas bolas que vienen. La última bola es de color rojo. Detrás de esa bola viene el cuerpo en estado de Jinas. Cuando ya el cuerpo se va acercando, el estudiante siente entonces que los hombros se le van poniendo pesados. Es tremenda la emoción que se siente cuando el cuerpo viene ante nosotros. Lo más curioso que asombra, es cuando descubrimos que el cuerpo físico también tiene conciencia, y responde a lo que le preguntamos.
Los devotos deben dominar en estos instantes toda emoción y controlar la mente para no fracasar en el experimento. Si el devoto se deja llevar de la emoción entonces instantáneamente ambos, cuerpo y devoto regresan instantáneamente a la cama, y fracasa el experimento aquí.
Trabajo de Mesa
Llámase en ocultismo Trabajo de Mesa el instante en que el cuerpo así invocado desde lejos debe inevitablemente entrar dentro del cuerpo sideral del devoto. Esta obra es difícil porque el cuerpo debe aprender, y el alma debe dominar la emoción y saber ordenar.
El cuerpo debe entrar dentro del alma por el Chacra coronario o loto de los mil pétalos situado en la parte superior de la cabeza sideral. Debe el devoto dar la orden al cuerpo, y el cuerpo obedece, si no obedece es porque no sabe; entonces el devoto debe enseñarle.
Se debe ordenar al cuerpo que salga sobre la cabeza sideral del cuerpo astral y que penetre dentro del devoto por esa puerta. El resultado es maravilloso. El cuerpo obedece y entra dentro del devoto (en el plano astral, no es el devoto quien debe entrar dentro del cuerpo. En el astral las cosas son diferentes. Allí es el cuerpo quien tiene que entrar dentro del devoto).
Así es como los devotos quedan con su cuerpo dentro del plano astral. El sistema Jinas de esta clave séptima, es para gente ya muy práctica en el uso y manejo del cuerpo astral.
Con el cuerpo en estado de Jinas podemos visitar los templos de la Gran Logia Blanca y recibir enseñanza directa de los grandes maestros que iniciaron la aurora de la creación.
Esto es lo que se llama Ocultismo Práctico, esto es lo que se necesita ahora urgentemente; ya los estudiantes de las distintas escuelas de ocultismo, se cansaron con justa razón de tanta teoría. Desgraciadamente la mayor parte de estudiantes quieren conseguir poderes regalados, sin esfuerzo, sin sacrificio, con toda clase de comodidades, rápidamente, en pocos días como soplar y hacer botellas.
Nosotros debemos advertir que todo cuesta en la vida, nada se consigue regalado. El que quiera tener estos poderes Jinas, debe tener la paciencia del Santo Job, el valor del tigre, la tenacidad del toro y sed inagotable de verdadera sabiduría divina.
Esta ciencia no es para gente inconstante. Los inconstantes, es mejor que renuncien a estos estudios. Esta ciencia tampoco es para gente curiosa. Con las leyes Cósmicas no se puede jugar impunemente sin quemarse. Ley es Ley, y lo sagrado se debe respetar.
Sustancias Jinas
Existen muchas sustancias que ayudan en la ciencia Jinas. El estudiante de ocultismo debe conocer esas sustancias y manejarlas. La ciencia Jinas es terriblemente divina. El huevo Orfico, el huevo de oro de Brahama, el huevo egipcio, etc., simbolizan claramente la materia prima de la Gran Obra. De la Materia Prima salen Universos, plantas, animales, hombres y dioses.
El Huevo está lleno de grandes poderes ocultos. El huevo de gallina es utilizado para los estados Jinas.
Entíbiese un huevo entre el agua. Despúntese por la parte puntiaguda. Extráigase la clara y la yema. Se debe extraer clara y yema por el orificio practicado en el huevo.
Redúzcase a polvo la corteza del huevo. Ese polvo es utilizado por los Yoguis para la ciencia Jinas.
Antes de hacer las prácticas Jinas todas las noches, debe el devoto echarse ese polvo en el pecho y debajo de los brazos, en la región vellosa de los sobacos. Después abríguese bien el estudiante y comience sus prácticas Jinas. Se puede tener una buena cantidad de este polvo para las prácticas Jinas.
En estos polvos se hallan los grandes poderes de la ciencia Jinas. Estos polvos son maravillosos.
El estudiante que se encuentra estudiando y practicando la ciencia Jinas debe inevitablemente acabar con tres pecados: ira, codicia, lujuria. Sólo así es posible evitar el ataque de los tenebrosos. Si el estudiante no corrige estos defectos tampoco logrará un progreso realmente positivo, en el sentido completo de esta palabra.
Los varones que se entregan a la ciencia Jinas deben usar para sus prácticas únicamente un pantalón de baño de color amarillo. Eso es todo. El cuerpo desnudo resulta mejor para las prácticas Jinas, porque los chacras giran libremente sin el estorbo de la ropa.
Las mujeres que practican con la ciencia Jinas, deben usar para sus prácticas, una túnica muy larga y ancha, lo más amplia posible. La túnica debe ser muy hermosa imitando las túnicas de las Samaritanas. La mujer que se entrega a la ciencia Jinas no debe recortarse el cabello. El cabello es realmente el símbolo del pudor y de la castidad en la mujer. En los antiguos tiempos a las mujeres adúlteras se les cortaba el cabello. Ese era su castigo.
La mujer que practica con la ciencia Jinas no debe usar para sus prácticas vestidos de baño como los hombres, porque eso es inmoral en la mujer. Las Jerarquías Divinas exigen modestia, pudor, castidad.
Estas túnicas amarillas para los Jinas, no son para asistir a los rituales gnósticos. Unicamente para la ciencia Jinas.
La túnica amarilla para la ciencia Jinas debe llevarse puesta directamente sobre la piel del cuerpo. Debajo de la amplia túnica no debe usarse ninguna otra pieza de vestir.
Utiles y perfumes
Se debe disponer siempre de un cuarto especial para trabajar con la ciencia Jinas. Empero cuando no se puede disponer de ese cuarto especial, entonces la recámara de dormir, la misma alcoba, puede convertirse en un verdadero santuario. Habiendo castidad todo anda muy bien.
Se debe sahumar la recámara diariamente con los cinco perfumes. Estos cinco perfumes son los siguientes: Incienso, Mirra, Aloe, Azufre, Alcanfor.
Es necesario pintar en el umbral de la pieza, el signo del pentagrama, la estrella de las cinco puntas. Los dos rayos inferiores deben estar hacia afuera. El rayo superior debe quedar hacia dentro. Esta estrella se puede pintar con carbón. También se puede pintar en un cuadro enmarcado con su vidrio, y ponerlo luego a la cabecera de la cama. En este caso el ángulo superior está hacia arriba, y los dos ángulos inferiores hacia abajo.
 La pieza o recámara debe estar toda adornada con colores amarillos, alfombras o tapetes amarillos, luz amarilla, adornos amarillos, etc.
El Iniciado además de su pantalón de baño amarillo, es bueno que tenga su bata de levantarse de color amarillo.
Dentro de la recámara o cuarto de trabajo deben estar siempre presentes la imagen del Cristo, Buda, y la Virgen. ya sea ésta representada como Isis, o la madre cósmica de la India, María, Tonantzín, o sencillamente como la blanca paloma del Espíritu Santo. Todas estas imágenes no representan a ninguna persona divina o humana, sino sencillamente a Dios Madre. Ya sabemos que Dios como Padre es Sabiduría, y como Madre es Amor. Como padre reside en el ojo de la sabiduría situado entre las dos cejas. Como Madre reside en el templo corazón. La serpiente sobre la vara también representa a la Divina Madre.
Debe seleccionarse cuidadosamente el símbolo que más nos guste, y usarlo en la recámara de trabajo.
Se debe tener un altar dentro de la recámara, y el fuego en el altar. Nunca debe faltar el fuego en la casa de un Iniciado.
Este es el Libro Amarillo, esta es la Sabiduría de los Budas, esta es la ciencia de la Mente Cósmica.
Los Budas usan manto amarillo. El color del mundo mental es el amarillo. Cuando el hombre se liberta de sus cuatro cuerpos de pecado, es un Buda. Todo Buda usa manto amarillo. El rayo del Cristo es el amarillo oro.
La ciencia de la mente constituye verdaderamente el Libro Amarillo. Este es el Libro amarillo porque es la ciencia de la mente.
El Iniciado debe encerrarse diariamente a las diez de la noche para trabajar en la ciencia de la mente.
El iniciado debe evitar cuidadosamente toda clase de discusiones y peleas con gentes incrédulas que ni hacen ni dejan hacer, que quieren que el mundo marche de acuerdo con sus sabihondas afirmaciones, llenas de necedad y malicia del peor género.
Los devotos deben bañarse diariamente. La habitación debe estar siempre aseada, pulcra, limpia.
La religión Jinas es muy Sagrada. Aquí en este Libro amarillo hemos enseñado la ciencia Sagrada de los Jinas, para todos los seres humanos, menos para los imbéciles. Los imbéciles ni la creen, ni la quieren, ni la aceptan porque son imbéciles.
Jamás deben faltar las flores en el cuarto de trabajo. Las flores, los perfumes, las imágenes simbólicas, la buena música, contribuyen a formar un ambiente lleno de Sabiduría y Amor.
V.M. Samael Aun Weor

Libro Amarillo.

En la meditación se debe combinar inteligentemente la concentración con el sueño. Sueño y concentración mezcla- dos producen Iluminación. Muchos esoteristas piensan que la meditación en modo alguno se debe combinar con el sueño del cuerpo, mas quienes así piensan se equivocan, porque la meditación sin sueño arruina el cerebro. Se debe siempre utilizar el sueño en combinación con la técnica de la meditación. Pero un sueño controlado, un sueño voluntario, no un sueño sin control, no un sueño absurdo; meditación y sueño combinados inteligente- mente.
La meditación es la disciplina esotérica de los Gnósticos.

La meditación reviste tres fases: Concentración, Meditación y Samadhí.
Concentración: significa fijar la mente en una sola cosa.
Meditación: significa reflexionar sobre el contenido sustancial de la cosa misma.
Samadhí: es éxtasis o arrobamiento.
Un maestro del Samadhí penetra en todos los planos de conciencia, y con el ojo de Dagma escudriña todos los secretos de la sabiduría del fuego.
Es urgente que nuestros discípulos Gnósticos aprendan a funcionar sin vehículos materiales de ninguna especie, para que perciban con el ojo de Dagma todas las maravillas del universo.
Así es como nuestros discípulos se harán maestros del Samadhí...
...Durante estas prácticas de meditación los chakras del cuerpo astral de nuestros discípulos entran en actividad y entonces el discípulo comienza a percibir las imágenes de los mundos suprasensibles.
Al principio el discípulo solo percibe imágenes fugaces, mas tarde el discípulo percibe totalmente todas las imágenes de los mundos suprasensibles . Esta primera etapa del conocimiento pertenece al conocimiento "Imaginativo".
El discípulo contempla entonces muchas imágenes que para el son enigmáticas porque no las entiende, pero conforme persevere en sus prácticas de meditación interna va sintiendo que esas imágenes suprasensibles producen en él ciertos sentimientos de alegría o de dolor.
El discípulo se siente entonces inspirado en presencia de esas imágenes internas y comprende la relación existente entre las diferentes imágenes, entonces se ha levantado el conocimiento "Inspirado".
Más tarde ve cualquier imagen interna y entonces instantáneamente conoce su significado y el porque de cada cosa, ésta es la tercera escala del conocimiento conocida con el nombre de conocimiento "Intuitivo".
Imaginación Inspiración e Intuición son los tres caminos obligatorios de la iniciación.
A estas tres cimas inefables se llega mediante la concentración, la meditación y el samadhí. Aquel que ha llegado a las cimas inefables de la intuición se ha convertido en un Maestro del Samadhí.
La sabiduría oriental se practica en el siguiente orden:
1.      ASANA (Postura del Cuerpo)
2.      PRATYARA (No pensar en nada)
3.      DHARANA (Concentración en una sola cosa)
4.      DYANA (Meditación profunda)
5.      SAMADHÍ (Éxtasis)

Es necesario colocar el cuerpo en la posición más cómoda (ASANA), es indispensable poner la mente en blanco antes de la concentración (PRATYARA), es urgente saber fijar la mente en una sola cosa (DARANA) y así llegamos a reflexionar profundamente sobre el contenido de la cosa misma (DYANA) por este camino llegamos al éxtasis (SAMADHÍ).
Toda esta disciplina esotérica de la mente debe empapar completamente nuestra vida cotidiana.
...Aquellos que quieren ingresar a la sabiduría del fuego tienen que acabar con el proceso del razonamiento y cultivar las facultades ardientes de la mente.
De la razón, sólo debemos extraer su fruto de oro que es la comprensión. La comprensión y la imaginación deben reemplazar a la razón.
Imaginación y comprensión son los cimientos de las facultades superiores del entendimiento.
Para ingresar al conocimiento de los mundos superiores es necesario adquirir las facultades superiores de la mente...
...Cuando en nuestro interior surge una imagen cualquiera hay que examinarla serenamente para conocer su contenido, cuando la rosa ígnea del cuerpo astral situada en el entrecejo despierta a una nueva actividad, entonces las imágenes que internamente vienen a nuestra imaginación van acompañadas de luz y colorido.
Hay que aprender por experiencia propia a hacer diferenciación entre las imágenes que son recibidas y las imágenes que consciente o inconcientemente creamos y proyectamos.
Hay que hacer diferencia entre las imágenes propias y las imágenes ajenas que vienen a nosotros.
La imaginación tiene dos polos uno receptor y otro proyector.
Una cosa es recibir una imagen y otra es proyectar una imagen creada por nuestro entendimiento.
El polo contrario de la imaginación es lo imaginario.
La imaginación es clarividencia.
Lo imaginario son las imágenes absurdas creadas por una mente llena de aberraciones. Los instructores no sólo deben entregar prácticas a los discípulos para el despertar del chakra frontal, sino también deben enseñarles a manejar la clarividencia.
La clarividencia es la imaginación cuyo chakra reside en el entrecejo, la imaginación es el traslúcido, para el sabio imaginar es ver...
...Tenemos que aprender a hacer diferencia entre lo que es crear una imagen con el entendimiento y lo que es captar una imagen que flota en los mundos suprasensibles.
Muchos dirán: ¿Cómo es posible que yo pueda captar una imagen sin ser clarividente?. A ellos tendremos que responderles que la imaginación es la misma clarividencia y que todo ser humano es mas o menos clarividente.
Lo que mas daño a causado a los estudiantes de ocultismo es el falso concepto que se tiene sobre la clarividencia. Los autores de ese falso concepto son los "intelectuales" que han mirado con el más profundo desdén las facultades de la imaginación.
Los ocultistas queriendo defenderse del desprecio intelectual le dieron un tinte marcadamente científico a la imaginación y la bautizaron con el nombre de clarividencia o sexto sentido.
Esta actitud de los ocultistas los perjudicó a sí mismos porque quedaron confundidos.
Ahora los ocultistas (víctimas de los intelectuales), han establecido un abismo terrible entre clarividencia e imaginación.
Muchos se preguntan a si mismos:¿Pero como puedo percibir imágenes sin ser clarividente?. Pobres gentes, no saben el tesoro que poseen, ignoran que la imaginación es la misma clarividencia y que todo ser humano es mas o menos clarividente.
Los ocultistas han querido convertir la bella facultad de la clarividencia en algo artificial, técnico y difícil.
La clarividencia es la imaginación, es la flor más bella, más sencilla y más pura de la espiritualidad.
Cuando reconquistamos la infancia perdida entonces todas las imágenes que vienen a nuestra imaginación van acompañadas de vivísimos colores astrales. El intelectual que desprecia la imaginación comete un gravísimo absurdo porque todo lo que existe en el naturaleza es hijo de la imaginación.
El artista que pinta un cuadro es clarividente, uno se queda anonadado ante el "CRISTO" de Leonardo da Vinci o ante la Madonna de Miguel Angel.

El artista percibe con su imaginación (Clarividencia) sublimes imágenes que luego pasa a sus acuarelas o a sus esculturas.
La "Flauta Encantada de Mozart" nos recuerda una iniciación egipcia cuando la diosa madre del mundo quiere entregarle al hombre algún juguete para que se divierta, entonces lo deposita en la imaginación de los inventores, así tenemos el radio, el avión, los automóviles, etc.
Las imágenes de los mundos sumergidos cuando son captadas por los científicos se convierten en cañones, ametralladoras, bombas, etc.
Así pues todo el mundo es mas o menos clarividente y no se puede despreciar la imaginación porque todas las cosas son hijas de la imaginación. Hay que hacer diferencia entre los hombres que no han recibido educación esotérica y aquellos que ya se han sometido a las grandes disciplinas esotéricas...
Práctica de Meditación
Quiero la felicidad para ustedes, la verdadera dicha del Ser.
Necesitamos que ustedes aprendan a meditar, en lo más profundo, que sepan meditar.
Cuando uno ha conseguido una verdadera concentración, llega a la verdadera dicha.
Vean ustedes, si yo no hubiera tenido en vida la experiencia del vacío iluminador, allá en mi mocedad, no estaría hablándoles ahora en la forma que les estoy hablando. Esa experiencia vívida, jamás se borró de mi conciencia ni de mi corazón.
Es posible que en una práctica de meditación profunda, pueda la conciencia de un ser humano escaparse de entre el ego y experimentar la dicha del vacío iluminador. Es obvio que si lo consigue trabajará con gusto sobre sí mismo, trabajará con ardor, pues habrá experimentado ciertamente, en ausencia del ego, Eso que es la Verdad. Eso que no es del tiempo, que está más allá del cuerpo, de los afectos y de la mente.
Aquí les he enseñado una forma sencilla de meditar, porque hay un tipo de meditación que está dedicado a la autoexploración del ego, con el propósito de desintegrarlo, volverlo cenizas. También hay otro tipo de meditación, que tiene por objeto llegar un día a la experiencia de lo real. Ojalá lo lograran ustedes, para que siguieran animados interiormente y trabajaran sobre sí mismos. Sin embargo, conceptúo que es necesario tener algún Mantram que sirva.
El Mantram que les voy a dar es muy sencillo: Gate, Gate, Paragate, Parasamgate, Bhodi, Swá, Ha. Este Mantram se pronuncia así: gaaateeeee, gaaateeeee, parasamgaaateeeee, parasamgaaaateeee, booodiiiii, suaaaa, jaaaaa. En nuestros corazones tiene que haber quedado grabado.
Este Mantram se pronuncia suavemente, profundamente y en el corazón. Puede también usarse como verbo silenciado, porque hay dos tipos de verbo: verbo articulado y verbo silenciado. El verbo silenciado es poderoso.
Este Mantram, entiendo que abre el ojo de dagma. Este Mantram, profundo, un día los llevará a ustedes a experimentar; en ausencia del ego, el vacío iluminador. Entonces sabrán lo que es el Sunyata, entonces entenderán ustedes lo que es el prajña-paramita.
Perseverancia es lo que se necesita, con este Mantram ustedes podrán llegar muy lejos.
Conviene experimentar la gran realidad alguna vez, eso lo llena a uno de ánimo para la lucha contra sí mismo. Esa es la ventaja del Sunyata. Esa es la ventaja más grande que existe en relación con la experiencia de lo real.
Y para que hoy se aproveche la meditación y el Mantram como es debido, vamos a entrar un rato en meditación con el Mantram.
Ruego a todos los hermanos, pues, entrar en meditación.
Se relaja el cuerpo, totalmente, después de relajado nos entregamos totalmente a nuestro Dios interior profundo. Sin pensar en nada, únicamente recitando con la mente y el corazón el Mantram completo.
La meditación debe ser honda, muy profunda, los ojos cerrados, el cuerpo  relajado, entregados completamente a nuestro Dios interior. 
Ni un pensamiento se debe admitir en estos instantes. La entrega a nuestro Dios debe ser total y solamente el Mantram debe resonar en nuestros corazón. 
-Apaguen las luces, relajen todo el cuerpo.
-Relajación completa y entrega total a nuestro Dios interior profundo.
-No piensen en nada de nada, de nada, de nada, de nada...
-Recitaré el Mantram, lo repetiré muchas veces para que no se les olvide: gaaateeeee, gaaateeeee, parasamgaaateeeee parasamgaaateeeee, booodiiii, suaaaaa, jaaaaa...
-Sigan repitiendo en sus corazones... no pensar en nada de nada... entreguémonos a nuestro Dios... 
-Siéntanse como un cadáver como un difunto.
 V.M. Samael Aun Weor

Conferencia: LA MEDITACIÓN.
Rosa Ignea.
Para Los Pocos.

Cómo triunfar en la Vida
La gran mayoría de gentes que habitan nuestra esfera sufren lo indecible por no saber comportarse conforme a los lineamientos de su propia naturaleza, padeciendo muchas veces extremadas situaciones de miseria e infelicidad, accidentes y enfermedades, que podrían ser resueltas si decidieran cambiar la obstinación que tienen por continuar en el mal.
Voy enseguida a proporcionar para las emprendedoras personas que quieran modificar sus condiciones de lamentable postración, sea esta física o psíquica, algunas sencillas recomendaciones que puedan seguir y así llegarán a comprobar cuán simple es lograr el Reino de los Cielos aún aquí en la Tierra.
Una de las mayores conquistas que se puede obtener aquí en esta tridimensionalidad espacial es la relativa a la salud, siendo ésta mixta, esto es física y espiritual; al respecto, casi la totalidad de las personas de alguna u otra forma, padecen enfermedades que si se trataran en forma adecuada y oportuna, podrían eliminarse fácilmente si acaso se siguiera una permanente disciplina respecto a nuestras conductas básicas y que lamentablemente son demasiado descuidadas, pues se ha ingresado a un estado de estupidez increíble al dedicar demasiada atención a aspectos materiales diversos, en detrimento de la propia persona humana, que requiere un equilibrio armonioso de su naturaleza así como también con el medio que le rodea.
Existen cuestiones tan elementales que corrientemente son dejadas de lado, y que, si volviésemos a darles la importancia del caso, deberán otorgarnos la reconquista de una inmejorable salud, que incidirá notablemente en la conducta, y de ese singular modo también proveerá un ambiente de armonía que por ley de asociación atraerá magnéticamente copiosos beneficios para quienes externen estados de felicidad y alegría contagiante.
Debo decir de una vez que hay que acostumbrarse a orar al iniciarse cada día, pero no como una grabadora o cualquier instrumento mecánico, que repite inconscientemente una intrascendente recitación, que ni se anhela ni se practica; por ello deberemos establecer una primordial asepsia mental, y en la intimidad de nuestros nobles sentimientos abrirnos a una real comunicación con el Creador, libre de otros observadores, que mayormente nos pueden dañar con sus críticas y burlas; así, hay que conscientizarse llegando a experimentar con la Oración un efectivo medio de contacto directo con la Divinidad íntima, la misma que está compuesta por nuestra Bendita Virgen Madre Kundalini, que adviene a Nos como consecuencia del estado de gracia interior que produce la verdadera Castidad, y no solamente con buenas intenciones o absurdos celibatos inventados por el hombre, mismos que dañan la psiquis y conllevan estados de histerismo como externación de las asqueantes energías satánicas denominadas venenoskirianas.
El mayor tesoro que se pueda lograr entre los mortales y aún válido hasta para los Divinos Seres, consiste en saber amar, siendo esa noble Virtud la que procesa en nuestro interior las formidables transmutaciones de la naturaleza celular en una potestad electrónica que induce al nacimiento del Hijo de nuestras Obras, el Kristo íntimo, el cual cotidianamente nos pide el sacrificio de la Cruz para darle de beber las Aguas de nuestro Génesis inmortal. "IO soy el Camino, la Gnosis y la Vida" dice solemnemente el Kristo encarnado en Jesús y prosigue clarificando: "Nadie llega al Padre sino por mí", "Io soy la Puerta y quienes violentan las ventanas buscando otros ingresos, esos tales son miserables salteadores", "De ellos será el llanto y el crujir de dientes" y "...aunque digan Señor, Señor, les dirá: Hijos del diablo sois, puesto que sus obras hacéis; apartáos de mí, hijos de Satanás, a vosotros no os conozco", pues quien niega al Hijo también niega al Padre, y el Kristo es el conducto directo para llegar a Él que es nuestro Maestro, el mismo que es la más excelsa Verdad; así pues, todos los mentirosos, estafadores, calumniadores, falsarios testificadores, incurren periódicamente en la negación del Padre, alejándose abismalmente de su gloriosa presencia, que es garantía de pleno éxito en la Vida.
Toda oración además de ser apacible, sincera, oportuna y gozosa, debe contener básicamente cuatro elementos, a saber:
1) Adoración a los Excelsos Seres de nuestra Trina Divinidad;
2) Agradecimiento sincero por todo aquello que recibimos así como también por todo lo que se nos quita, honrando de este modo la Suprema Voluntad del Padre que sabe cuál es lo mejor para Nos;
3) La petición específica de cada ocasión, que cuando es lícita y avalada por un ruego auténtico y sincero, es inmediatamente atendida;
4) Finalmente, hay que saber pedir perdón por todos los pecados cometidos, solicitando a la vez una protección permanente, para que el poderoso Escudo Jehovístico nos libre de caer en tentaciones y así podamos permanecer incontaminados en cuerpo, Alma y Espíritu.
Un buen baño todas las mañanas y también previo a acostarnos, no sólo mejora nuestro estado general de la materia, sino que además proporciona una buena inyección de energía psíquica, amén de la prestancia e higiene del cuerpo que emite el perfume natural con que se llega a impresionar favorablemente a nuestros interlocutores, pero antes, habrá de efectuarse algunos ejercicios rúnicos, o de simple gimnasia, para exudar las sustancias tóxicas provenientes de la pésima alimentación que consumimos cotidianamente, para luego recién proceder con la bendición que otorga un agradable duchazo de abundante y natural agua fría.
Hay que comenzar cada nueva jornada haciendo gala de optimismo, dejando fuera de nuestra psiquis todo temor, timidez, desconfianza, avaricia, orgullo, vanidad, lujuria, etc., y más bien acorazarnos con una real dosis de seguridad en lo que vamos a ejecutar, para lo cual, habremos de plantear previamente un mínimo plan de acción, el mismo que se debe procurar cumplir, para luego, ya en horas de la noche, hacer una sincera evaluación de todo lo acontecido y someternos a una drástica auto- crítica, censurando todo lo malo en que hayamos incurrido, auxiliados por el maravilloso procedimiento de la retrospección que es una auténtica facultad del Alma, y así podernos ver de cuerpo entero tal como somos, sin tapujos de ninguna especie, pero revestidos de la poderosa capacidad de enmienda.
La alimentación, aparte de buscar que sea lo más natural posible, debe estar siempre acompañada de una Acción de Gracias, lo mismo que de una Bendición, para que la mesa y su contenido se convierta en una verdadera Obra de Magia, mediante la cual se produce el milagro de la mutación de las comidas materiales en fuentes proveedoras de Energía Divinal o Shakti de Pránico Potencial.
Efectuemos siempre un trabajo que nos agrade, que condiga con la vocación a la cual nos sentimos atraídos, para lo cual deberemos buscar no la mejor utilidad mercantilista como hoy ocurre al escogerse una carrera, sino la satisfacción por lo que se hace, así sea como zapateros o labriegos.
Busquemos servir a cuantos podamos, antes de esperar ser servidos; empeñémonos al máximo en contribuir a la satisfacción común de los intereses del vecindario, pueblo o villa donde radiquemos, brindando sin cálculos de ninguna especie, todo el apoyo que fuere preciso para encontrar soluciones prácticas a los requerimientos sociales de nuestras colectividades.
El Sagrado Signo del Padre sea siempre loado en toda actividad que se nos presente, y jamás deberá perderse la animosidad para intervenir gustosos en cuanta ocasión fuere menester nuestro concurso solidario.
A.Z.F., V.M.K. El Tawa Manú
(Extracto del Libro: El Advenimiento de Thunupa El Krísto Rojo de Acuario)

Al inicio de cada jornada, con infinita Fe y verdadero Amor por la Humanidad, se deberá decir:
Que alcance equilibrio la Madre Natura
pudiendo los Seres unirnos un día
colmados de Luz festejar la Armonía
gozando las Almas suprema Ventura.
Antes de comenzar una Oración o cualquier práctica iniciática, se debe decir con gran fervor:
Gloria al Signo Bendito impronunciable
cuyo Magno Misterio ha descendido
otorgando a los Seres trascendidos
Verbo Luz que conduce al Adorable.
Al concluír toda práctica, con verdadera convicción se debe decretar así:
En Mí brilla el Gran Tesoro realizado
fluye regio su Magnífico torrente
cuya Mágica Letra en son silente
dióme al Ser y me hallé resucitado.
En momentos de dolor, temor, tristeza, soledad, u otras angustias de la vida, se deben contrarrestar estas situaciones, diciendo con vehemencia:
Salud gozo en mi Madre Bendita;
Omnisciencia en mi Padre Glorioso;
Plenitud en mi Kristo Amoroso,
Dios en Mí que Virtudes suscita.
Asimismo, también he compuesto unos breves pero poderosos Himnos, que deberán entonarse con gran fervor, así:
Acción de Gracias por cada nuevo Día:
El Sol nuevo Día despierta
su Amor a los frutos madura,
feliz, luminosa y experta
renace la Madre Natura.
Acción de Gracias por la diaria Nutrición:
Alegres las Almas alcemos
por estos Benditos Nutrientes
y al Cielo las Gracias brindemos
gozando sus Dones ingentes.
Acción de Gracias por el Día transcurrido:
La noche ha llegado serena
Urania ya luce estrellada,
el Ser me brindó Vida Plena
Su Luz se halla en Mí Realizada. Aom…

Con la preparación ritualística adecuada, operando los Elementos correspondientes, y en concordancia con el actual calendario vigente en la Tierra, se deberá realizar un Circuito Energético a las 9 de la mañana de cada día 9 de los próximos 9 meses, esto es de Enero a Septiembre de 1.999, trabajando con el Glorioso Señor Melkisedek hasta llegar internamente al Templo Corazón de la Tierra, para que gracias a su valiosa intercesión, y tal como lo establece el Libro de las Revelaciones, se logre alcanzar mediante las invocaciones Mántricas IAO, IO y AOM, la correspondiente restauración ultrafisiológica de los órganos internos relacionados con el HIGADO, RIÑONES Y CORAZON, mismos que por ahora se encuentran seriamente dañados como fatal consecuencia de los respectivos vicios de fornicación, actos antinatura y las relaciones sostenidas, con matrimonio o sin el, fuera de los encantos del auténtico Amor Erogénico.


A) Filosofía introductiva

Como quiera que en el Mes de Marzo del año 2002 en realidad ingresaremos al Noveno de la Nueva Era Acuaria que es cuando se presentará de modo propicio un Equiflux Cósmico (Equilibrio armónico bio-magnético-psico-sexual) que viene siendo una expresión más adecuada para explicar lo que es un Jubileo Celestial, corro con el riesgo y asumo la delicada responsabilidad de plantear a quienes, ansiosos de iniciación cierta pero cansados de falacias y/o teorías vanas, y luego de que hayan aceptado los indubitables dones de la bien entendida Castidad Científica y estén practicando sus benéficos resultados, puedan acceder a una tangible comprobación contundente "Aquí y ahora".
Considero que quien esto lea y analice, no se esforzará en comprender la natural anatomía cartilaginosa del esternón que llevamos en el pecho uniendo las costillas que emergen de la Columna Vertebral, y en cuya cavidad llevamos físicamente por delante el corazón y el hígado, mientras que por atrás tenemos los pares de pulmones y riñones.
Quienes siguiendo la esencia de mis anteriores Mensajes ya hubieran adelantado - en su día y en su hora precisa de cada mes - algo de las prácticas que mi Ser entrega con la intervención del Maestro Melkisedek para la reparación de corazón, hígado y riñones, de conformidad a lo que veladamente se aconseja en el Libro de Revelaciones o Apocalipsis de las Sagradas Escrituras, y en cuya constancia es posible lograrse verdaderos milagros de regeneración anímico celular, podrán comprobar sin sugestiones a priori, las maravillas que esta vez con el INTERION pueden operar los pulmones, habiendo sido habilitados para responder a los supremos impulsos de la Memoria Cósmica, recuperada la condición de procesar el Maná Celestial, esto es, las características etéricas contenidas en el oxígeno hidrogenado heliónicamente mediante el Sagrado Eroar.
Aclaro: mediante el esternón nuestra naturaleza orgánica está consignada a recibir los beneficios materiales que devienen del impulso respiratorio regular o semiconsciente, que permite a la vez la sabia combinación equilibrada del indispensable funcionalismo vegetativo del cuerpo, en cuyo resultado lógico puede otorgar al individuo común una salud abundante con toda la extraordinaria satisfacción que eso significa y que culmina en el verdadero deleite de vivir, esto es, recuperando la felicidad del Paraíso terrenal, irguiéndose nuevamente como Hombre en la escala evolutiva por encima de la condición meramente animal.
Otra cosa supremamente superior es poder vencer la fatalidad de los estigmas del pecado que ha llevado por eones a los hombres de barro a soportar la aparente insalvable situación de necesidad material, constreñidos al parto doloroso, el hambre, la enfermedad y la muerte, anatemas que persisten en los alicaídos descendientes de Adán y Eva que conformamos las humanidades del inconmensurable espacio existente por debajo de la cuarta coordenada dimensional.
Por si todavía no ha sido advertido por los investigadores serios, y a fin de premiar su dedicación y búsqueda sincera, debo enfatizar que la naturaleza tridimensional alberga lo que vendría en denominarse el Paraíso terrenal que corresponde a las especies que mantienen su original inocencia, libres de todo pecado, aunque sin poder acceder a las escalas de la Divinidad, esto es, sin llegar a disfrutar los encantos del Arbol de la Vida mediante el cual se permite a los intrépidos superar la mera creación material.

B) Preparativos para la práctica

A) La pareja laborante requiere disponer de un ambiente más o menos espacioso, sea cubierto o despejado para llevar a efecto esta práctica.
B) Ambos participantes deben de encontrarse preferentemente en ayunas.
C) Es recomendable que previamente hubiesen orado y meditado juntos.
D) Hay que tener preparado un pequeño Altar, que se halle libre de la curiosidad de extraños.
E) Sobre el Ara deben estar dos candeleros conteniendo cada uno tres cirios encendidos y las Sagradas Escrituras o Pistis Sofía, o mejor ambas.
F) Espada en mano El y con un Cáliz conteniendo Agua sin químicos Ella, dirán al unísono:
Por la Gloria del Señor Jehová, Invocamos las Potencias del Altísimo para conjurar y alejar de aquí todo mal. ITABABO HÁGASE LUZ. QUE ASÍ SEA.
G) Luego hay que mentalizar una Cruz o un trébol de cuatro hojas o un doble ocho dispuesto horizontal y verticalmente partiendo desde el punto central.
H) El Interion se divide en tres partes y una síntesis o Jubileo; una es positiva y masculina, operando con la Runa Inti; otra es negativa y femenina procesando la Runa Inkaos, la tercera es mixta y se ejecuta con la Runa Gibur, mientras que la Obra se sella con la Runa Krisol que es el Equiflux constituyendo la fusión de lo Humano con lo Divino, o como se llama en Lenguaje Divino al Sagrado Tetragrama: Kona-Tiki Wira-Kocha o IEVE como se le conoce entre quienes pretenden encarnarle y que aún no han adquirido la dignidad de invocarle y ver TAL COMO ES.

C) El "Modus operandi"

C1) La postura del hombre en la Runa INTI, es inclinarse casi de cuclillas extendiendo las manos hacia arriba, permitiendo que la mujer suba sobre sus hombros, agarrando aquél las manos de su pareja e irguiéndose ambos para lentamente ejecutar la respectiva Runa, comenzando con el pie izquierdo y la mano derecha de EL, llevando a cabo la Cruz en Movimiento o Cruz de Andrés a modo de pausada caminata con leve balanceo de las manos hacia adelante y atrás, tal como procedían en la Antigua Arkadía los Sacerdotes Tiahuanakotas , Mayas y Aztecas entre otros Grandes Iniciados de la Antigüedad.
Con lúcida imaginación y concentración plena, realizarán ambos el Trébol Viviente en su primer pétalo partiendo del centro hacia arriba o el Norte, a la vez que por cuatro veces mantralizan así: IIIIIIIIINNNNNNNNN TTTTTTTTTIIIIIIIII.
C2) Con el mismo procedimiento, pero esta vez con la Runa INKAOS, es la mujer quien lleva en hombros a su pareja y empezando del centro hacia abajo o el Sur, con el pie derecho y la mano izquierda, iniciarán el segundo paso soltando suavemente por cuatro veces el Mantra IIIIIIIIINNNNNNNNN KKKKKKKKKAAAAAAAAA OOOOOOOOOSSSSSSSSS cerrando el pétalo nuevamente en el centro.
C3) De igual modo como se procedió antes, pero volviendo el hombre a llevar a la mujer, la Runa GIBUR empieza con el pie derecho y la mano izquierda, iniciándose el tercer paso desde el centro hacia la derecha o el Este, diciendo por cuatro veces GGGGGGGGGIIIIIIIII BBBBBBBBBUUUUUUUUURRRRRRRRR, hasta que retornan al centro de la Mística Flor.
C4) Se finaliza esta secuencia volviendo la mujer a levantar al hombre esta vez con la Runa KRISOL, dando inicio al Equiflux con el pie izquierdo y la mano derecha, partiendo del centro hacia la izquierda diciendo cuatro veces el Mantra KKKKKKKKKRRRRRRRRRIIIIIIIII SSSSSSSSSOOOOOOOOOLLLLLLLLL hasta llegar nuevamente al centro.
C5) Erguidos ambos se dirigen al pequeño Altar para beber alternativamente el Agua contenida en el Cáliz, luego de lo cual, apagan las velas y levantan el Altar.
C6) Dentro de los siguientes veinte minutos deben proceder a ducharse, si posible con agua fría.
C7) Viviendo el más completo Amor y la más grande pureza, la pareja llega al deleite del supremo Eroar, concentrados en los pulmones desbaratando con imaginación creadora todo antiguo o reciente recuerdo de guerra, odio, ira, pleito, controversia, antipatía o enemistad, mantralizando: SSSSSSSSSOOOOOOOOOLLLLLLLLL VVVVVVVVVEEEEEEEEE.
C8) Ahora la imaginación consciente se concentra en el Corazón para decretar con el Mantra CCCCCCCCCOOOOOOOOO AAAAAAAAAGGGGGGGGGUUUUUUUUU AAAAAAAAALLLLLLLLL el Renacimiento o la Paz Espiritual con el advenimiento del Amor, la Armonía, la Dulzura, la Simpatía, la Amistad, virtudes que entre muchas otras se ven refulgir triunfantes desde nuestra Naturaleza Kristificada.
C9) Aún conectados en la Alkimia con el Sagrado Eroar, oran a la Madre Divina, visualizando la irradiación luminosa y la deliciosa fragancia perfumada que emanan del Manto de la Purísima particularizada en el Original Andrógino así renacido, aunque uniendo este fulgor al brillo singular de la Patrona de México, la clementísima Virgen Guadalupana, vigorizando la concentración consciente al enviar este Esplendor de Paz en favor de todos los estantes y habitantes de esta nuestra Madre Tierra, para que sin distinción de raza, sexo, edad, cultura, doctrina o condición social, de este singular modo recuperemos el verdadero sentido de la Navidad que nos legó el Adorable Salvador Jesús El Kristo, cuyo espíritu dimana triunfal la auténtica comunión y universalidad entre todas las especies de la Creación.

D) La secuencia regeneradora

Esta práctica debe ejecutarse en pareja constituida legítimamente los días 9 a horas 9 a.m. durante nueve meses sin soltar ni una sola vez por encima de cualquier otra obligación o tarea existente, comenzando según el calendario gregoriano en el mes de Marzo que corresponde al primero y concluyendo en Noviembre que en realidad es el noveno mes de la secuencia correcta del calendario Soli-lunar que consta de trece períodos o lunaciones y que para entonces estará en su Noveno Año.

A.Z.F., V.M.K. El Tawa Manú
(Extracto del Mensaje de Navidad 2001 "Que Reine la Verdadera Paz")

Con la finalidad de exorcisar el mal que se quiera cometer contra el Laborante, éste debe - enviando mentalmente supremo Amor y Caridad a cuantos le hayan ofendido - operar el Mudra Pentálfico con los dedos de la mano derecha de la siguiente manera:
Yérganse Júpiter, Saturno y Marte, flanqueados por Venus que se impone a Mercurio. Dicho de otro modo y para que no hayan equívocos al respecto, deben elevarse los dedos anular, medio e índice, mientras que la yema del pulgar se posa sobre la uña del meñique, a la vez que simultáneamente se dice en lo físico o interno: POR LA GLORIA DEL KRISTO CÓSMICO, INVOCO LA POTENCIA DE MI DIVINO REAL SER, PARA CONJURAR Y ALEJAR DE MÍ TODO MAL: ITABABO HÁGASE LUZ.

Todas las mañanas al despertar, es bueno efectuar una retrospección de lo acontecido en ciertos divinales parajes que dejan de constituir propiamente el mundo de los sueños, y así poder aprovechar los simbólicos mensajes que se nos presentan alegóricamente, aprendiendo de este modo a desentrañar una serie de claves e incógnitas tanto del propio interior psicológico como del entorno que nos rodea; Al efecto, cada despertar, es aconsejable no mover ni tocarse la cabeza, pues con estos ademanes casi siempre se pierde el fabuloso bagaje onírico que podría ser estudiado en estado de vigilia para obtener las radiantes luces que beneficien nuestro correcto accionar en la vida diaria.
Tanto en las mañanas como al atardecer, es bueno saludar al Kristo Sol con la mantralización Inti; De pié, pero doblando la columna y extendiendo las manos con las palmas abiertas hacia el Astro Rey se debe invocar al Kristo íntimo así: Primero hay que inhalar oxígeno todo lo que se pueda y luego lanzarlo suavemente con la invocación
Asimismo, se deben mantralizar las siguientes poderosas fuerzas del Olimpo Original:








Podría darles una buena cantidad de prácticas que rescatan los sublimes trabajos que pueden ejecutarse con el Rayo Inka, pero para un inicio esto es más que suficiente, debiendo los que se encuentren interesados, esperar mis próximos libros para ir adosando nuevas técnicas, y mientras tanto les aconsejo que prueben lo que aquí les adelanto, con la seguridad de que constituyen claves poderosísimas para el despertar de la Consciencia y el superior desarrollo interior.
Lo importante por ahora es querer sinceramente regenerarse, para lo cual hay que aprender a adorar al Padre, acostumbrándose a decir sólo la Verdad; venerar a la Madre Bendita, desarrollando la más absoluta Castidad y honrar al Kristo íntimo, sabiendo Amar de verdad a nuestros congéneres, como a toda la maravillosa naturaleza que el Cielo ha dispuesto para nuestro solaz, y de ningún modo para su destrucción.

Pues bien, la manera de vencer hasta a la misma muerte física en la disolución de la personalidad, que es su proceso natural cuando el Realizado ha limpiado a plenitud sus establos psicológicos, y desencarnando libera a su Pistis Sofía de los procesos  karmáticos preexistentes, con la Fe puesta en el resultado triunfal, el procedimiento a realizarse es como sigue:
Cuando se presente en el ambiente una tormenta eléctrica poderosa, colmada de rayos y truenos y mejor aún si hay copiosa lluvia, siempre y cuando el Laborante se sienta merecedor de realizar esta práctica y estando con el estómago vacío, puesto en posición o mudra como ejecutando exactamente la misma Runa FA en dirección a donde se originan los estruendos y refulgencias, pidiendo ser alcanzado por tal poder para eliminar la personalidad, visualizando tal energía purificadora mantralice así:         

Inmediatamente en posición de Runa SIG y Espada en mano, cierre la Obra con tal Runa, diciendo cuatro veces: 
Las dos primeras en equis, de izquierda a derecha y de abajo hacia arriba, y las dos siguientes en cruz latina, de Sur a Norte y de izquierda a derecha.
Quien tenga méritos triunfará en su cometido, sea desencarnando de ipso facto o fulminantemente, o mejor aún, quedará limpio y sin la botella en cuanto conserve esa materia, mientras que el falto de idoneidad, lo más probable es que desencarne sin beneficio alguno o que permanezca existiendo plagado de taras físicas y/o psíquicas y hasta rematadamente loco. 
A quienes les cause pavura lo que comento, mejor ni se aventuren a intentarlo, pues de antemano ya estarán descalificados, y para quienes tengan el valor y firmeza para ejecutar merecidamente esta singular proeza, tengan plena confianza, pues mi Ser da plena Fe de que sí se puede lograr tal objetivo, y de ahí en adelante, todas las sucesivas prácticas en ese sentido, serán de poderosas recargas energéticas y conscientivas, mismas que evitarán posteriores embotellamientos egoicos.

Follow by Email

Te Invitamos a Suscribirte

Grupos de Google
Suscribete a LA SAGRADA IGEOM.
Correo electrónico:
Consulta al grupo